ID: 1042323457

View in Genome Browser
Species Human (GRCh38)
Location 8:67503400-67503422
Sequence GGTCCTCCCTCCTCAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042323455_1042323457 -7 Left 1042323455 8:67503384-67503406 CCTCCTGAGTTCAACAGGTCCTC 0: 1
1: 0
2: 22
3: 708
4: 11047
Right 1042323457 8:67503400-67503422 GGTCCTCCCTCCTCAGCCTCTGG No data
1042323456_1042323457 -10 Left 1042323456 8:67503387-67503409 CCTGAGTTCAACAGGTCCTCCCT 0: 1
1: 0
2: 6
3: 95
4: 1507
Right 1042323457 8:67503400-67503422 GGTCCTCCCTCCTCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042323457 Original CRISPR GGTCCTCCCTCCTCAGCCTC TGG Intronic
No off target data available for this crispr