ID: 1042323458

View in Genome Browser
Species Human (GRCh38)
Location 8:67503403-67503425
Sequence ACTCCAGAGGCTGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71000
Summary {0: 14, 1: 479, 2: 2771, 3: 19447, 4: 48289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042323458_1042323465 -8 Left 1042323458 8:67503403-67503425 CCTCCCTCCTCAGCCTCTGGAGT 0: 14
1: 479
2: 2771
3: 19447
4: 48289
Right 1042323465 8:67503418-67503440 TCTGGAGTAGCTGGGACTACAGG 0: 1302
1: 9603
2: 118577
3: 247901
4: 241623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042323458 Original CRISPR ACTCCAGAGGCTGAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr