ID: 1042323461

View in Genome Browser
Species Human (GRCh38)
Location 8:67503409-67503431
Sequence TCCTCAGCCTCTGGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541320
Summary {0: 70, 1: 3295, 2: 19822, 3: 235990, 4: 282143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042323455_1042323461 2 Left 1042323455 8:67503384-67503406 CCTCCTGAGTTCAACAGGTCCTC 0: 1
1: 0
2: 22
3: 708
4: 11047
Right 1042323461 8:67503409-67503431 TCCTCAGCCTCTGGAGTAGCTGG 0: 70
1: 3295
2: 19822
3: 235990
4: 282143
1042323456_1042323461 -1 Left 1042323456 8:67503387-67503409 CCTGAGTTCAACAGGTCCTCCCT 0: 1
1: 0
2: 6
3: 95
4: 1507
Right 1042323461 8:67503409-67503431 TCCTCAGCCTCTGGAGTAGCTGG 0: 70
1: 3295
2: 19822
3: 235990
4: 282143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042323461 Original CRISPR TCCTCAGCCTCTGGAGTAGC TGG Intronic
Too many off-targets to display for this crispr