ID: 1042323463

View in Genome Browser
Species Human (GRCh38)
Location 8:67503410-67503432
Sequence CCTCAGCCTCTGGAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 694806
Summary {0: 2984, 1: 16415, 2: 226878, 3: 278634, 4: 169895}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042323456_1042323463 0 Left 1042323456 8:67503387-67503409 CCTGAGTTCAACAGGTCCTCCCT 0: 1
1: 0
2: 6
3: 95
4: 1507
Right 1042323463 8:67503410-67503432 CCTCAGCCTCTGGAGTAGCTGGG 0: 2984
1: 16415
2: 226878
3: 278634
4: 169895
1042323455_1042323463 3 Left 1042323455 8:67503384-67503406 CCTCCTGAGTTCAACAGGTCCTC 0: 1
1: 0
2: 22
3: 708
4: 11047
Right 1042323463 8:67503410-67503432 CCTCAGCCTCTGGAGTAGCTGGG 0: 2984
1: 16415
2: 226878
3: 278634
4: 169895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042323463 Original CRISPR CCTCAGCCTCTGGAGTAGCT GGG Intronic
Too many off-targets to display for this crispr