ID: 1042323465

View in Genome Browser
Species Human (GRCh38)
Location 8:67503418-67503440
Sequence TCTGGAGTAGCTGGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619006
Summary {0: 1302, 1: 9603, 2: 118577, 3: 247901, 4: 241623}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042323456_1042323465 8 Left 1042323456 8:67503387-67503409 CCTGAGTTCAACAGGTCCTCCCT 0: 1
1: 0
2: 6
3: 95
4: 1507
Right 1042323465 8:67503418-67503440 TCTGGAGTAGCTGGGACTACAGG 0: 1302
1: 9603
2: 118577
3: 247901
4: 241623
1042323458_1042323465 -8 Left 1042323458 8:67503403-67503425 CCTCCCTCCTCAGCCTCTGGAGT 0: 14
1: 479
2: 2771
3: 19447
4: 48289
Right 1042323465 8:67503418-67503440 TCTGGAGTAGCTGGGACTACAGG 0: 1302
1: 9603
2: 118577
3: 247901
4: 241623
1042323455_1042323465 11 Left 1042323455 8:67503384-67503406 CCTCCTGAGTTCAACAGGTCCTC 0: 1
1: 0
2: 22
3: 708
4: 11047
Right 1042323465 8:67503418-67503440 TCTGGAGTAGCTGGGACTACAGG 0: 1302
1: 9603
2: 118577
3: 247901
4: 241623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042323465 Original CRISPR TCTGGAGTAGCTGGGACTAC AGG Intronic
Too many off-targets to display for this crispr