ID: 1042323662

View in Genome Browser
Species Human (GRCh38)
Location 8:67505034-67505056
Sequence CAGTGTACCCACAGGTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042323662_1042323670 28 Left 1042323662 8:67505034-67505056 CCTGAGTACCTGTGGGTACACTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1042323670 8:67505085-67505107 GGTTACAGTGCTGCTGTATATGG No data
1042323662_1042323664 -7 Left 1042323662 8:67505034-67505056 CCTGAGTACCTGTGGGTACACTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1042323664 8:67505050-67505072 TACACTGTCCTTCTCTTCCTTGG No data
1042323662_1042323666 7 Left 1042323662 8:67505034-67505056 CCTGAGTACCTGTGGGTACACTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1042323666 8:67505064-67505086 CTTCCTTGGAAATTTAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042323662 Original CRISPR CAGTGTACCCACAGGTACTC AGG (reversed) Intronic
900529311 1:3144932-3144954 CAGTGAACCCCCAGGGCCTCAGG + Intronic
901712047 1:11123379-11123401 CAGTGTAGTCCCAGCTACTCAGG - Intronic
903219635 1:21861976-21861998 TAGGGTACCCACATGTTCTCTGG + Exonic
907210730 1:52819341-52819363 TACTGTACCCACAGGTTCTGAGG + Intronic
907302924 1:53499644-53499666 CAAAGGACCCACAGGTCCTCTGG + Intergenic
909030551 1:70534103-70534125 CAGTGTAGTCCCAGCTACTCGGG - Intergenic
909267073 1:73573907-73573929 CACTGTAGCCACAGGTACTGTGG - Intergenic
918009892 1:180576948-180576970 CAGTGGCCCCCCAGGTTCTCCGG - Intergenic
918883696 1:190162306-190162328 CACTGTAATCACAGCTACTCGGG - Intronic
921601653 1:217112509-217112531 CAGTGTACCTAAAGGTCTTCAGG + Intronic
923346689 1:233060487-233060509 CTGTGTACCCCCAGGACCTCTGG + Intronic
923605427 1:235438918-235438940 CAGTGTATACGCACGTACTCAGG - Exonic
923803095 1:237229507-237229529 CAATGTACCAACAGGAACTCTGG - Intronic
923803112 1:237229594-237229616 CAATGTCCCAACAGGAACTCGGG - Intronic
1062985001 10:1760295-1760317 CACTGTAATCCCAGGTACTCTGG - Intergenic
1063495152 10:6500791-6500813 CAGTTTACTCACAGCTGCTCAGG - Intronic
1063992159 10:11577841-11577863 CAATGTAGCTACAGGTACTAAGG - Intronic
1064347619 10:14547127-14547149 CAGTGTACCCAGAAGAACCCTGG - Intronic
1065643836 10:27814183-27814205 AAGTGCACCCACAGGGACTCTGG - Intronic
1066892142 10:40927816-40927838 CAGTGTAATCCCAGCTACTCGGG - Intergenic
1068682313 10:59833571-59833593 CAGTGGACCCATAGGGACTTGGG + Intronic
1074853270 10:117455581-117455603 CAGAGTACCCACAAGTCCTCTGG + Intergenic
1075684872 10:124356794-124356816 CAATGTAGCCCCAGGAACTCTGG + Intergenic
1082044989 11:47718183-47718205 CAGTCTACCAACAGGGACCCTGG + Intronic
1082183574 11:49150078-49150100 CACTGTAATCCCAGGTACTCAGG - Intronic
1083154345 11:60813615-60813637 CTGTGTACCCACAGATGCTTGGG - Intergenic
1086682783 11:89695267-89695289 CACTGTAATCCCAGGTACTCAGG + Intergenic
1090238103 11:125164432-125164454 CGGTGGACCCCCAGGAACTCTGG - Intergenic
1090962045 11:131565734-131565756 CAGAGTCCCCACAGGATCTCAGG - Intronic
1091757541 12:3064345-3064367 CAGTGTAATCCCAGTTACTCAGG - Intergenic
1092283872 12:7117491-7117513 CAGAGCCCCCAAAGGTACTCTGG - Intergenic
1093386293 12:18559408-18559430 AAGGGAAACCACAGGTACTCTGG + Intronic
1093663799 12:21788269-21788291 CAGTGCACACACACGTACTGAGG + Intergenic
1093773916 12:23050030-23050052 CAGTGGTCCTACAGGTTCTCAGG + Intergenic
1100301194 12:93309519-93309541 CCCTGTAACCACAGCTACTCAGG + Intergenic
1102374710 12:112412597-112412619 CACTGTACTCCCAGCTACTCAGG - Intronic
1104927228 12:132320125-132320147 CATTGTACCCACACGGACTTGGG - Intronic
1107766817 13:43744369-43744391 CAGTGTACCAACAGCTAATGAGG + Intronic
1109469233 13:62783241-62783263 CAGTATTCCCACAGTTTCTCAGG + Intergenic
1110681468 13:78318411-78318433 TAGTTTACCCACAGGTACAAAGG - Intergenic
1110816726 13:79869268-79869290 CCAGGTACACACAGGTACTCAGG + Intergenic
1110977324 13:81855577-81855599 CTGTGTACCCACACGTATTACGG - Intergenic
1115425514 14:33254381-33254403 CAGTGTCCACTCAGATACTCAGG + Intronic
1116341834 14:43733334-43733356 CAGAGTACCCATAGGTCTTCAGG + Intergenic
1116723725 14:48533939-48533961 CAGTGGTCCCCCAGGTTCTCAGG + Intergenic
1117144858 14:52827281-52827303 CTCTGTAGCCACAGCTACTCAGG + Intergenic
1117459020 14:55926381-55926403 AAATTTACCCACAGGTGCTCTGG - Intergenic
1117698192 14:58387687-58387709 GCGTGTACTCACAGGTACTTGGG - Intergenic
1123097652 14:105774027-105774049 CAGTGTAGCCACAGGTGAGCAGG - Intergenic
1125638603 15:41210563-41210585 CAGTGTAGCCCCAGCTACTCAGG + Intronic
1128549311 15:68587815-68587837 CAGTGTTCCCACAGCCAGTCAGG + Intronic
1128822577 15:70673147-70673169 CAGGGTAACCCAAGGTACTCAGG + Intronic
1131442298 15:92468145-92468167 CAGTGTGCACAGAGGTAATCTGG - Exonic
1133719624 16:8482926-8482948 GAGTGTACTCACAGCTACTTGGG - Intergenic
1135001830 16:18782908-18782930 CAGTGTAGCCACAGCTTCTGCGG - Exonic
1135490687 16:22906676-22906698 CATTGTGCCCACAGGGGCTCTGG - Intronic
1136244902 16:28969309-28969331 CAGTGTGCACACAGGTTGTCTGG + Intergenic
1136619591 16:31419227-31419249 CAGTGGACCCACATTTACTACGG + Intronic
1137030740 16:35522017-35522039 AAGTTTACCCAAAGGTACTATGG + Intergenic
1137274744 16:46926003-46926025 CAGTGTAATCCCAGCTACTCTGG + Intronic
1142046295 16:87927240-87927262 CAGAGTAGCCACAGGAAGTCTGG + Intronic
1142601433 17:1054785-1054807 CAGTTTGCCCCCAGGAACTCAGG + Intronic
1151928830 17:77217892-77217914 CAGTGTGTCCACAGGCAGTCAGG + Intergenic
1152582149 17:81170886-81170908 CCCTGTACCCACAGGCACCCAGG + Intergenic
1156193483 18:34746628-34746650 TAGTCTCCCCACAGGGACTCTGG + Intronic
1157582697 18:48782630-48782652 CAGTGCACCCACAGGGCCACAGG + Intronic
1159238128 18:65704343-65704365 CAGTGTAGCAACAGGAAATCAGG - Intergenic
1159998333 18:74990158-74990180 CAGTGAAACTTCAGGTACTCGGG + Intronic
1161489275 19:4552938-4552960 CAGTGTCCCCACATGTACAATGG - Intronic
1161528826 19:4774444-4774466 CACTGTAGTCACAGCTACTCAGG + Intergenic
1162417554 19:10547147-10547169 CTGGGTACCCGCAGGCACTCAGG + Intronic
1162424542 19:10586607-10586629 CTGTGTAGTCACAGCTACTCCGG + Intronic
1164865893 19:31604072-31604094 GAGTGTCCCCACAGGAACTTGGG - Intergenic
1166042035 19:40209535-40209557 GACTGTAACCACAGCTACTCGGG - Intronic
1166208333 19:41288172-41288194 ATGTGAACCCACTGGTACTCGGG + Intronic
1166512219 19:43416542-43416564 CAGTGAGACCACAGGTACCCTGG + Exonic
926081286 2:9988501-9988523 CCGGGTACCAACAGGTACACAGG - Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927198898 2:20566404-20566426 CTTTGGACCCACAGGTGCTCAGG - Intronic
931758235 2:65393454-65393476 CTGTGTAGTCACAGCTACTCGGG - Intronic
932244039 2:70181445-70181467 CACGGAACCCACAGGTCCTCTGG - Exonic
936538646 2:113332333-113332355 CATTGTACCCACAGGTAGTGAGG - Intergenic
937714882 2:125021017-125021039 GGGTGTACCCACAGTTACTCTGG + Intergenic
938617860 2:133018277-133018299 CAGTGTGCCCTCAAGAACTCAGG - Intronic
942026647 2:171917260-171917282 CACTGTAGCCCCAGCTACTCGGG + Intronic
943501349 2:188693352-188693374 CAGTGTAGCCACGGGTGCCCCGG - Intergenic
945216304 2:207437587-207437609 AAATGTACCCACATGTGCTCAGG - Intergenic
947079551 2:226380823-226380845 CAGTGTTCCCTCGGGTTCTCAGG + Intergenic
948440939 2:237988489-237988511 CACTGTAGCCCCAGCTACTCGGG + Intronic
1168860553 20:1043415-1043437 CAGTGATCCCACAGGAGCTCTGG + Intergenic
1169417394 20:5429183-5429205 GAGTGTACTCCCAGCTACTCAGG + Intergenic
1172187044 20:33037378-33037400 CAGTCTACCCACCTGTACACTGG + Intronic
1174440558 20:50548840-50548862 AACTGTAACCCCAGGTACTCAGG - Intronic
1175941702 20:62540331-62540353 CAGTGTACCCAGGCGTACCCAGG - Intergenic
1177450086 21:21255213-21255235 CAGTGTACTCCAACGTACTCGGG - Intronic
1180970804 22:19814374-19814396 GAGTGTAGTCACAGCTACTCAGG - Intronic
950424868 3:12919713-12919735 CAGGGTTCCCACAGGGACTGAGG + Intronic
954734671 3:52696465-52696487 CACTATACCCACAGATACCCAGG + Intronic
955896345 3:63704855-63704877 CAGTGTACCCAAAACTACCCCGG + Intergenic
959904081 3:111691700-111691722 CAGTGCACACAAAGATACTCTGG - Intronic
963173837 3:142278472-142278494 TAGTGTAATCACAGATACTCGGG - Intergenic
967984211 3:195083276-195083298 CAGTTTACACACAGGTAGACAGG - Intronic
970368268 4:15383123-15383145 TGCTGTACCCACATGTACTCAGG + Intronic
970635501 4:18005473-18005495 CAGTGTCCCAGCAGGGACTCTGG + Intronic
970942736 4:21654577-21654599 CAGTGTTTCCCCAGGTACTTGGG - Intronic
971811838 4:31437998-31438020 CACTGTAACCCCAGCTACTCAGG + Intergenic
973074921 4:45912172-45912194 GATTGTAGTCACAGGTACTCAGG + Intergenic
975280941 4:72561378-72561400 CAGTGTAGTCCCAGCTACTCGGG + Intronic
977422664 4:96822592-96822614 TAGTGTACCAACAGGTAACCAGG + Intergenic
982788559 4:159564054-159564076 CAGTGTAGTCCCAGCTACTCAGG - Intergenic
983268779 4:165536820-165536842 CAGTGTTCTCACAGCTCCTCTGG + Intergenic
984935078 4:184882817-184882839 CAATCTACTCACAGGCACTCTGG - Intergenic
985113021 4:186565300-186565322 ATGTGTACCCTCAGGTACTTGGG - Intergenic
988619768 5:32811192-32811214 CAGTGAACATACAGCTACTCGGG + Intergenic
992034645 5:72760617-72760639 CAGTGGCCCCCCAGGTTCTCAGG + Intergenic
993503672 5:88688083-88688105 CAGTTAACACACAGGTACTGGGG + Intergenic
1000661865 5:163948264-163948286 GAGGGCACCCACAGGAACTCTGG - Intergenic
1003219417 6:4145282-4145304 CAGTGACTCCACAGGTACACAGG + Intergenic
1003353758 6:5345519-5345541 CACTTTACCCACAGCTTCTCAGG + Intronic
1003461274 6:6330973-6330995 CAGTGTAGGCACAGGTCTTCTGG + Intergenic
1005151272 6:22754109-22754131 CAGTGTTCCCCCTGGTCCTCAGG + Intergenic
1007252188 6:40503319-40503341 CAGTTCTCCCACAGCTACTCAGG + Intronic
1007374400 6:41446352-41446374 CAGAGTAGCCCCAGCTACTCTGG - Intergenic
1007760834 6:44132785-44132807 CACAGCACCCACAGGTTCTCTGG + Intronic
1010682104 6:78809186-78809208 CAGTGTACCAAGGGGTACTCAGG + Intergenic
1011557878 6:88588242-88588264 CATTGTGCACACAGGGACTCGGG - Intergenic
1011677265 6:89746995-89747017 CAGTGTCACCACAGGTAGTCTGG - Intronic
1011997435 6:93610294-93610316 CACTGTAGTCACAGCTACTCAGG - Intergenic
1020010364 7:4803198-4803220 CAGTGTGCCCCGAGGTACCCGGG - Intronic
1020010513 7:4803537-4803559 CAGTGTGCCCCGAGGTACCCGGG - Exonic
1020130889 7:5558033-5558055 CAGTGTACCCAACGGGACACAGG + Intronic
1020243264 7:6411500-6411522 TAGTGTAGCCCCAGCTACTCAGG + Intronic
1020675298 7:11176901-11176923 CAGTGAATCCCCATGTACTCAGG + Intergenic
1022080278 7:27013093-27013115 CACTGGACCCACAGGAACTTGGG + Intergenic
1023046402 7:36214171-36214193 CAGTGAACCCACCTGTGCTCTGG - Intronic
1024042551 7:45566598-45566620 CAGGATGCCCAAAGGTACTCAGG - Intergenic
1024142340 7:46474902-46474924 CAGTTTATCCATGGGTACTCTGG + Intergenic
1029148787 7:98465680-98465702 CAGTGTACCCTCAACTTCTCTGG + Intergenic
1031785391 7:126024689-126024711 TATTGTAGCCACATGTACTCTGG + Intergenic
1031943038 7:127809462-127809484 CAGTGAACACCCATGTACTCTGG + Intronic
1032128761 7:129212546-129212568 CAGTCAGCCCACAGGTTCTCTGG - Exonic
1032339839 7:131060237-131060259 CAGTGTACACACATGTAATCTGG - Intergenic
1033194396 7:139315098-139315120 AACTGTACTCCCAGGTACTCAGG - Intergenic
1041272645 8:56124151-56124173 CAGTGTACCTATCGGTACACTGG - Intergenic
1041272646 8:56124152-56124174 CAGTGTACCGATAGGTACACTGG + Intergenic
1041697669 8:60753747-60753769 GACTGTAGCCCCAGGTACTCTGG - Intronic
1042323662 8:67505034-67505056 CAGTGTACCCACAGGTACTCAGG - Intronic
1052374657 9:27705317-27705339 CAGTGAACCCACAGCTTCACTGG - Intergenic
1054789038 9:69237572-69237594 CAGTGTAGTCCCAGCTACTCAGG + Intronic
1055760165 9:79598499-79598521 CATTTTACCCTCAGTTACTCAGG + Intronic
1057612293 9:96555875-96555897 CAGCGTTCTCACAGGGACTCTGG - Intronic
1058024342 9:100124451-100124473 CACTGTAGCCCCAGCTACTCAGG + Intronic
1062705062 9:137934169-137934191 CACTGTTCCCACAGGTTCACAGG + Intronic
1185964486 X:4585309-4585331 CAGTGTAATCCCAGCTACTCAGG + Intergenic
1188870912 X:35370645-35370667 CAGTGTCCCCACAGGGATTAAGG - Intergenic
1189676078 X:43461875-43461897 CAGTGTAATCCCAGCTACTCAGG + Intergenic
1189793190 X:44622985-44623007 CACTGTAATCACAGCTACTCGGG - Intergenic
1189905108 X:45750772-45750794 CAGTGTAGTCACAGGATCTCAGG - Intergenic
1190234236 X:48603726-48603748 CACTGTCCCCACAGGTAACCTGG - Intronic
1196730952 X:118941043-118941065 CCATGTAGCCCCAGGTACTCGGG + Intergenic
1197204283 X:123776537-123776559 CAGTGTAGTCGCAGCTACTCAGG + Intergenic
1198557193 X:137807718-137807740 GAGTGTAGTCACAGCTACTCAGG + Intergenic
1199996157 X:153028112-153028134 CAGTGTGCCCTCAGCCACTCTGG - Intergenic
1202587205 Y:26443960-26443982 AAGTGTAGCCCCAGCTACTCAGG - Intergenic