ID: 1042324056

View in Genome Browser
Species Human (GRCh38)
Location 8:67509554-67509576
Sequence CTCATTCACATGTTCTCTAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042324056 Original CRISPR CTCATTCACATGTTCTCTAT TGG (reversed) Exonic
904490246 1:30854183-30854205 CTCATTCACATGTTCAAGATGGG + Intergenic
905446508 1:38031236-38031258 CTCTTTCTCATGTTCCCTCTGGG - Intergenic
906884418 1:49629158-49629180 TTCATTTACATATTGTCTATAGG + Intronic
907806466 1:57825365-57825387 CTCACTTACTTGTTCTCTACTGG - Intronic
909176239 1:72364480-72364502 CTCATTGAAATGGTCTCTCTTGG + Intergenic
909215013 1:72875789-72875811 AAAATGCACATGTTCTCTATAGG - Intergenic
910469173 1:87532865-87532887 GTCTTTCACATATTGTCTATAGG + Intergenic
911015760 1:93330312-93330334 CTCATTTACATGGTCTCAATTGG - Intergenic
914404137 1:147353898-147353920 CTCACTCTCATTTTCTCTCTTGG + Intergenic
917621273 1:176798872-176798894 CTCCTTCACAGCTTCTCTAGAGG - Intronic
917639230 1:176966637-176966659 CTGATACACATGTGCTGTATTGG - Intronic
920282348 1:204853760-204853782 CTCATTCACACCTTCACCATGGG - Intronic
921647192 1:217632445-217632467 CTCATTGACATATTTTCCATTGG - Intronic
1064415725 10:15148020-15148042 CTCTTTCACATTTTATCTCTAGG + Intronic
1067356539 10:45533881-45533903 CCCATTTACATGCTCTCTATGGG - Intronic
1067859654 10:49832297-49832319 CTCATTCCCATGTACTGCATCGG + Intronic
1069013400 10:63400344-63400366 CACACTCACATGTTGTTTATTGG - Intronic
1073976969 10:109112945-109112967 CTCTTTCTCATGATCTCTCTGGG - Intergenic
1078544014 11:12233738-12233760 TTTATTCTCATGTTCTCTTTGGG + Intronic
1079033210 11:17001046-17001068 CTCCTTCACATTTTCTGCATTGG + Intronic
1083383987 11:62293894-62293916 CTCATTCTCATGTTCATTAGTGG + Intergenic
1089864639 11:121621035-121621057 ATCATTCACTTGTTCTTTTTTGG + Intronic
1090972438 11:131654971-131654993 CACATGCACATGTACTCAATCGG + Intronic
1092901634 12:13065186-13065208 CTCATTCACAGTAGCTCTATGGG - Intronic
1093578151 12:20759729-20759751 CTACTTCATATGTTTTCTATTGG + Intergenic
1095485224 12:42677577-42677599 TACATCCACATGTTCTCTGTGGG - Intergenic
1096934798 12:55259775-55259797 GTTATTCACATGTTCTCTCAAGG - Intergenic
1098640939 12:72838343-72838365 CTCATTCCTCTGTTCTCCATGGG - Intergenic
1099358729 12:81670556-81670578 CTCAATCCCATCTCCTCTATTGG + Intronic
1099411467 12:82334155-82334177 CTCATTCAAATCTGCTCTTTAGG + Intronic
1099660673 12:85556144-85556166 CTCTTCCACATGTTATCCATTGG + Intergenic
1101045684 12:100803411-100803433 CTCACTCAGATGTTCTATATTGG - Intronic
1101655458 12:106716302-106716324 TGCATTCCCATGTTCTCAATGGG + Intronic
1102702982 12:114855899-114855921 CTCATTTACGTGTTCCCTAATGG + Intergenic
1106161404 13:27204264-27204286 CTCCTGCCCATGTTTTCTATTGG - Intergenic
1106278340 13:28237430-28237452 CTGGTTCACAGGTTCTCTAGGGG - Intronic
1106513680 13:30433900-30433922 CTGATTCTCATGTTCTAAATAGG - Intergenic
1108770515 13:53694855-53694877 CTAATTCATATCTTCTCTCTGGG + Intergenic
1109337544 13:61011329-61011351 ATTATGCAGATGTTCTCTATCGG - Intergenic
1111223202 13:85233384-85233406 CTCACCCACATTTTCTCCATAGG - Intergenic
1111898614 13:94172565-94172587 TTCATTAACATATTCTCTATGGG + Intronic
1112770563 13:102790462-102790484 CTCATCCAAATGTTCTGTCTGGG - Intronic
1113362119 13:109641094-109641116 CTCATTCACATGTTCAGGATGGG + Intergenic
1115307075 14:31944415-31944437 CTCCTCCTCATGTTTTCTATAGG + Intergenic
1117713252 14:58554557-58554579 CTCATGCAGATTTTCTCTCTAGG - Intergenic
1120452791 14:84691296-84691318 TTCATTCACATCTTCTTGATGGG - Intergenic
1120646270 14:87078267-87078289 CCCATTAGCATGTTCTTTATTGG + Intergenic
1121913911 14:97818815-97818837 CTCATTAACATGCTCTTTTTTGG - Intergenic
1124041547 15:26110221-26110243 CTCATGACCATGTTCTCTGTAGG + Intergenic
1127164089 15:56225764-56225786 CTGACTCACATCTTCCCTATAGG + Intronic
1127438567 15:58983227-58983249 CTCATTAAAATTTTCTATATGGG - Intronic
1134353608 16:13461036-13461058 CTCGTTGATATGTTGTCTATTGG - Intergenic
1135950974 16:26913802-26913824 CTCATTAACATGGTCTGCATTGG + Intergenic
1140396075 16:74627934-74627956 TTCATTCACAGGTTCTTTCTAGG - Intronic
1144144914 17:12388083-12388105 ATCATTCACATCCACTCTATTGG - Intergenic
1147403755 17:40196042-40196064 CTCATCCACATTTTCTTTTTTGG - Intergenic
1148390782 17:47270900-47270922 CCCATTTACATGTTTTATATTGG + Intronic
1152911565 17:83008184-83008206 CTCATTCACATCTGCTCACTGGG - Intronic
1154091902 18:11372678-11372700 CTCATTCAAATATTCTGTAGAGG + Intergenic
1156765413 18:40648249-40648271 CTCTCTCAGATGTTCTTTATAGG + Intergenic
1158076919 18:53541473-53541495 CTCAATACCATGTTCCCTATGGG - Intergenic
1162148564 19:8629109-8629131 CTCATTCACAAGTTCCAGATGGG + Intergenic
1163563724 19:18036834-18036856 CTCATTCAACTGTACTTTATTGG + Intergenic
1164525491 19:29010296-29010318 CTAATTCACATGCACACTATTGG + Intergenic
1165525984 19:36355088-36355110 CTCATTCACATCTGCTCCACTGG + Intronic
927021911 2:19025878-19025900 CTCAAACACATGTTCTTTATGGG - Intergenic
928138973 2:28711190-28711212 ATCCTTCACATGTTCAATATAGG - Intergenic
933128765 2:78645968-78645990 CTCATTTACAAGTTCACTTTGGG + Intergenic
939607207 2:144267822-144267844 TTCATTCACATGCTCTAAATAGG + Intronic
939680334 2:145123327-145123349 CTTTTTCCCATGTTCTCTAAAGG - Intergenic
940744428 2:157551828-157551850 TTCATTCACATGTTCTCATATGG + Intronic
941208876 2:162610303-162610325 CTCATTTAGCTGTTCTCTAAAGG - Intronic
941545106 2:166840487-166840509 CTTATTCACATTTTCTTCATTGG - Intergenic
941930359 2:170932632-170932654 CACATCCAAATGTTCTCTAATGG - Intronic
944450281 2:199835504-199835526 CCCATCCACCTATTCTCTATTGG - Intronic
945216323 2:207437908-207437930 CTCATTCATTTGTGCTCTCTCGG - Intergenic
945636163 2:212353988-212354010 CTCATTGAAATGTTCAGTATAGG - Intronic
945915800 2:215702764-215702786 CTCATTAACATGCTCCATATAGG + Intergenic
946717681 2:222570159-222570181 CTCATTCATATGTCATCTTTTGG + Intergenic
1169296801 20:4407047-4407069 TTCATTCACATAATCTATATTGG - Intergenic
1169408776 20:5349170-5349192 CTCAATCAGATCTTCTCTATTGG + Intergenic
1170425681 20:16233113-16233135 CCCAGTAACATGTCCTCTATGGG + Intergenic
1173151282 20:40568389-40568411 CTGATTCACATGTGCTCTGCTGG - Intergenic
1174671122 20:52308540-52308562 CTCATTAACATACTCTGTATGGG + Intergenic
1174726464 20:52867867-52867889 CTCACTCATATGTTTTTTATTGG - Intergenic
1176045420 20:63090194-63090216 CTCAGTCACATGTTCTGCTTGGG + Intergenic
1177022814 21:15884400-15884422 TTCATTCACTTGTGCTCTGTTGG + Intergenic
1177845786 21:26285955-26285977 CCCATTCACTTGTTCTTTTTTGG + Intergenic
1179016860 21:37601437-37601459 CTCATTGTCATGTCCTCTGTTGG + Intergenic
1179592397 21:42417693-42417715 TTCATTCACACGTGCTCTCTGGG - Intronic
1181490221 22:23256806-23256828 TTTATTCACCTGTTCTCTGTTGG + Intronic
1181942493 22:26489304-26489326 CTCATTCACTTGTTGACCATGGG - Intronic
1182038346 22:27216780-27216802 CTCATTCACACACTCTGTATTGG + Intergenic
951385657 3:22039088-22039110 CTCGTTCACATGGTCTGCATAGG - Intronic
956373775 3:68592203-68592225 TTCCTACACATGTTCTCCATTGG - Intergenic
957761562 3:84564835-84564857 GTCATTCACATCTACTCTTTTGG - Intergenic
958589882 3:96142663-96142685 CTCATTTACATGATATCTCTAGG + Intergenic
959218919 3:103490083-103490105 CTCAATCACATTATCTCTTTAGG + Intergenic
961431366 3:126886233-126886255 CTGATTCACAAGTTCTCTTTTGG + Intronic
962565672 3:136656653-136656675 CTCATTCTCCTTTTCTCCATAGG - Intronic
963604803 3:147405129-147405151 CTCATTCTCCTGTTCTCTAGAGG + Intronic
964658476 3:159094087-159094109 CTCCTTTACATGTTTTCTCTTGG + Intronic
965140080 3:164821486-164821508 TTCATTCACATGTTCTGTAATGG - Intergenic
965435989 3:168652198-168652220 CACATTCATATTTTCTCTTTGGG + Intergenic
966018421 3:175173676-175173698 TTCATTTTCATGTTCCCTATTGG + Intronic
967491321 3:190094507-190094529 CTGATTCACATTTTCCCTACAGG + Intronic
967849286 3:194070448-194070470 CCCATTCCCAACTTCTCTATGGG + Intergenic
970205875 4:13655035-13655057 CTCATTAACATGCTGTTTATTGG - Intergenic
971428930 4:26543287-26543309 CTGATTCGCATGTTCTGAATTGG - Intergenic
972154442 4:36141791-36141813 ATCATTCACACTATCTCTATAGG + Intronic
972980210 4:44689416-44689438 TTCATTCACATGTGTTTTATAGG + Intronic
974719059 4:65713080-65713102 CACATGTACATGTTATCTATGGG + Intergenic
975732448 4:77350887-77350909 CTCATAAACAAGTTGTCTATTGG + Intronic
977795395 4:101158673-101158695 CTCATTCAGATATTATTTATGGG - Intronic
982407330 4:155034949-155034971 AATATTCACATGTACTCTATAGG - Intergenic
983619057 4:169740775-169740797 CTCAATCATATCTTCTTTATGGG + Intronic
984171733 4:176368107-176368129 CTCAGCCCCAAGTTCTCTATGGG + Intergenic
984264651 4:177483271-177483293 CTCATTTCCATATTTTCTATAGG + Intergenic
986130765 5:4927873-4927895 CTAATACTCATGATCTCTATTGG + Intergenic
986167832 5:5291338-5291360 CTCATTCACATGTGGTCCACAGG - Intronic
986233821 5:5889291-5889313 ATCATTCATTTGTACTCTATTGG + Intergenic
987735427 5:21836498-21836520 CTCCTTCACATTTTCTATAATGG + Intronic
988030363 5:25756087-25756109 CTAATTCAGAAGTTCTCTAAAGG - Intergenic
989106744 5:37869934-37869956 ATTATTCACATGTTCTTTTTAGG + Intergenic
989773773 5:45177564-45177586 TTCATACACAGTTTCTCTATTGG + Intergenic
990749361 5:58996687-58996709 AGCATCCACATGTTCTCTTTGGG - Intronic
993066715 5:83108938-83108960 CACTTTCACATTTTCTCTATTGG - Intronic
995003769 5:107166219-107166241 CTGATTCCCATGTGCTCTAAGGG + Intergenic
995947069 5:117660783-117660805 CACATTCACATATACTATATTGG - Intergenic
996290289 5:121844676-121844698 CACATTCACAGGTTCTGGATGGG + Intergenic
997576626 5:134983277-134983299 CCCATTCATATGTTGTCTACAGG + Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1003270154 6:4601303-4601325 CTCAGCCACATGACCTCTATGGG + Intergenic
1004416705 6:15431207-15431229 CACATTCACATGATCTGTAAGGG - Intronic
1005815891 6:29552606-29552628 CTCCTCCTCATGTTCTCTCTGGG - Intergenic
1006900546 6:37497877-37497899 TTCATTCTCATGTTTTTTATTGG - Intronic
1007201273 6:40111434-40111456 ATAATTCACATGTTGTCTAGGGG + Intergenic
1009443409 6:63710416-63710438 CTCATTCACATGTTTTCCTTAGG + Intronic
1009738947 6:67719225-67719247 CTCATTCACAAGTAGTGTATGGG + Intergenic
1014468612 6:121786567-121786589 ACCAATTACATGTTCTCTATGGG - Intergenic
1016039200 6:139414403-139414425 CCCATTGAAATTTTCTCTATAGG + Intergenic
1017244221 6:152204907-152204929 ATGATTAACATGTTCTCTACAGG + Intronic
1022857803 7:34332872-34332894 CTCAATAACATGTTGTCAATGGG - Intergenic
1023125035 7:36946877-36946899 CTCACTCACCTTTCCTCTATAGG + Intronic
1024901812 7:54326759-54326781 CTAATTCACAAGCTCTATATTGG + Intergenic
1025533849 7:61923677-61923699 TTTATTCACATTTTCACTATAGG - Intergenic
1028233463 7:88332167-88332189 CTCATTTAGATGTTTTCTATTGG + Intergenic
1029532627 7:101135528-101135550 GTCATTCCCAGGTTCTCTAGGGG - Exonic
1029601716 7:101567878-101567900 CTCATTCACTATTTTTCTATTGG - Intergenic
1029866587 7:103637689-103637711 TTCTTTCACATGTTGTCTAATGG + Intronic
1032231275 7:130076728-130076750 CTGATTGAAATGTTGTCTATAGG + Intronic
1032973095 7:137187691-137187713 TTCGTTCACATGTACTCTAATGG - Intergenic
1034045692 7:147924629-147924651 CTCATTCCCCTTTTCTCTACAGG - Intronic
1037804718 8:22052828-22052850 CTCATCCACATGTGCTACATGGG - Intronic
1039913061 8:41839947-41839969 CCCATGCACAGTTTCTCTATTGG - Intronic
1042324056 8:67509554-67509576 CTCATTCACATGTTCTCTATTGG - Exonic
1042724850 8:71862350-71862372 CTTCTTCACATGTTCTTTCTTGG + Intronic
1042952172 8:74211759-74211781 AAAATTAACATGTTCTCTATGGG + Intergenic
1043602618 8:81958966-81958988 CCTAATCACATGTTCCCTATGGG - Intergenic
1045658557 8:104412032-104412054 CTCCTTCCCATGTGCTCTCTGGG + Intronic
1048937707 8:139370626-139370648 CTCAGTCACATATTCGCTATGGG + Intergenic
1050410219 9:5356340-5356362 TTCTTTCCCATGTTCTCTAGGGG + Intergenic
1050465276 9:5915991-5916013 CACATTCACATTTTCTCTCCAGG + Intronic
1052823382 9:33157239-33157261 ATCATTCACAGGTTCTAAATTGG - Intronic
1054968504 9:71057479-71057501 TTCATTCTCATCTTTTCTATAGG + Intronic
1055014864 9:71605402-71605424 TTCATTCTAATCTTCTCTATGGG + Intergenic
1055044767 9:71912238-71912260 ATCATTCACATTTCCTCTATGGG - Intronic
1056027215 9:82511549-82511571 TTGAGTCACATGTTCCCTATTGG + Intergenic
1056282906 9:85059429-85059451 TTCACTCACATTTTCTCTATAGG - Intergenic
1058241607 9:102569271-102569293 CTTTTTCACATGTTCTTTAGTGG - Intergenic
1059781993 9:117539429-117539451 TTCATTTACAACTTCTCTATTGG + Intergenic
1186397095 X:9220702-9220724 CTGATGCACACCTTCTCTATGGG + Intergenic
1186928864 X:14365213-14365235 ATCAGTCACATGTCCTCCATGGG - Intergenic
1187780427 X:22816369-22816391 TTCAAACTCATGTTCTCTATTGG - Intergenic
1189613059 X:42757008-42757030 CACTTACACATGTTCTCCATGGG - Intergenic
1189697991 X:43685488-43685510 CTAATTCAAATGTTGTCTGTAGG - Intronic
1189791099 X:44605781-44605803 CCCATTTATATGTTCTTTATTGG + Intergenic
1190096984 X:47489380-47489402 ATAATTCACATTTTCTCTATTGG + Intergenic
1190929652 X:54936320-54936342 CTCAGTCACATCATCTCTCTGGG + Intronic
1191077934 X:56475721-56475743 CTCACTGACATGTTCTTTCTTGG + Intergenic
1192436160 X:71145076-71145098 CTCAACCCCATGTTCTCCATCGG + Intronic
1193861894 X:86678411-86678433 CTCACTAACATGTTTTCTTTTGG - Intronic
1194247256 X:91530797-91530819 CCCTTTCACATGTTCACTGTTGG + Intergenic
1194427995 X:93763533-93763555 CAGATTAACATCTTCTCTATGGG - Intergenic
1196020563 X:110986681-110986703 CTCATTCACATTTTCTAGATAGG + Intronic
1197833209 X:130667461-130667483 CTTAGTCACTTGCTCTCTATGGG - Intronic
1198325482 X:135567358-135567380 CCCATTCACATGGACTCTCTAGG - Intronic
1198706043 X:139449057-139449079 CTCATTCACATGTGCATTCTTGG + Intergenic
1200316670 X:155140038-155140060 CTCATTCTCATTTTTTCCATAGG - Intronic
1200566278 Y:4772335-4772357 CCCTTTCACATGTTCACTGTTGG + Intergenic