ID: 1042330773

View in Genome Browser
Species Human (GRCh38)
Location 8:67578360-67578382
Sequence GTTACATTTGAGCACTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042330773_1042330777 11 Left 1042330773 8:67578360-67578382 CCCTCAAAGTGCTCAAATGTAAC No data
Right 1042330777 8:67578394-67578416 CCCAACCCATGACTTTTGATTGG No data
1042330773_1042330782 26 Left 1042330773 8:67578360-67578382 CCCTCAAAGTGCTCAAATGTAAC No data
Right 1042330782 8:67578409-67578431 TTGATTGGCTGTTGGTGATTTGG No data
1042330773_1042330781 18 Left 1042330773 8:67578360-67578382 CCCTCAAAGTGCTCAAATGTAAC No data
Right 1042330781 8:67578401-67578423 CATGACTTTTGATTGGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042330773 Original CRISPR GTTACATTTGAGCACTTTGA GGG (reversed) Intronic