ID: 1042330773

View in Genome Browser
Species Human (GRCh38)
Location 8:67578360-67578382
Sequence GTTACATTTGAGCACTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042330773_1042330777 11 Left 1042330773 8:67578360-67578382 CCCTCAAAGTGCTCAAATGTAAC 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1042330777 8:67578394-67578416 CCCAACCCATGACTTTTGATTGG No data
1042330773_1042330781 18 Left 1042330773 8:67578360-67578382 CCCTCAAAGTGCTCAAATGTAAC 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1042330781 8:67578401-67578423 CATGACTTTTGATTGGCTGTTGG No data
1042330773_1042330782 26 Left 1042330773 8:67578360-67578382 CCCTCAAAGTGCTCAAATGTAAC 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1042330782 8:67578409-67578431 TTGATTGGCTGTTGGTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042330773 Original CRISPR GTTACATTTGAGCACTTTGA GGG (reversed) Intronic
902088542 1:13883354-13883376 ATTCTCTTTGAGCACTTTGAAGG + Intergenic
909122331 1:71618853-71618875 GTTTTATTTGAGCATTTTGTGGG + Intronic
909425974 1:75525263-75525285 GTTAAATTTGATCACTTTGTTGG - Intronic
910426553 1:87124984-87125006 ATTTCCTTTGAGCATTTTGATGG + Intronic
912255530 1:108054315-108054337 GGTACAGCTGAGCACTTAGAAGG - Intergenic
913215770 1:116619098-116619120 ATTTCATTTGAGCACTTGGCTGG - Intronic
913236624 1:116790241-116790263 GTTACATTTTAGAACTTTTATGG - Intergenic
914801389 1:150965115-150965137 ATGTAATTTGAGCACTTTGAGGG - Intronic
915594680 1:156889570-156889592 TTCACATGTGAGCTCTTTGAGGG + Intergenic
915822000 1:159034073-159034095 AATACATTTGAGAACCTTGAAGG + Intronic
919298150 1:195727593-195727615 TTTTCATTTCAGTACTTTGAAGG + Intergenic
922926191 1:229348625-229348647 GTCACAGTTGTGCAGTTTGAGGG + Intergenic
924118760 1:240774688-240774710 GTTAAATGTGAGAATTTTGAGGG + Intergenic
924600121 1:245481378-245481400 GTTACATTTGAGCACGGGAATGG - Intronic
1062826991 10:577652-577674 GTTAGATCTGAGCACCTTGAAGG - Intronic
1064479075 10:15721470-15721492 CTTACATTTGGGCACTGTGGGGG + Intergenic
1064516892 10:16159583-16159605 GTTATACTGGAGCAATTTGAAGG + Intergenic
1068608849 10:59036229-59036251 TTTCCTTTTGAGCTCTTTGAAGG + Intergenic
1077987288 11:7366025-7366047 GTCACATTTCAGTACCTTGAAGG - Intronic
1080144203 11:28960302-28960324 ATTCCATTTGAGAACTTTGATGG + Intergenic
1081100278 11:38993191-38993213 GTCACATTTGTAAACTTTGATGG + Intergenic
1082105748 11:48219515-48219537 GTTCCTTTTGAACACTTTCATGG + Intergenic
1086075032 11:82841495-82841517 ATTACATTTGAGCATGTTAAAGG - Intronic
1087702098 11:101446444-101446466 GTCACATTTGAGCAATATGTGGG - Intergenic
1087784833 11:102342683-102342705 GCTACATTTGAGCAATTACATGG + Intergenic
1089726771 11:120487842-120487864 GTTAAATTACAGCACTTTGGGGG - Exonic
1090134641 11:124184670-124184692 ATTACATTTGAGCAGTAGGAAGG - Intergenic
1091066838 11:132522132-132522154 GTTACATTTGACAACTTGGATGG - Intronic
1092265755 12:6979117-6979139 GATACATTTGGGCACTTCTAGGG - Intronic
1094267195 12:28572744-28572766 GTTGCATTTGAGCTGTATGAGGG - Intronic
1095036485 12:37383985-37384007 GAGTGATTTGAGCACTTTGATGG + Intergenic
1095063895 12:37740801-37740823 GTTATTTGTGAGCCCTTTGAGGG + Intergenic
1095067464 12:37796273-37796295 GATACTTGTGAGAACTTTGAGGG + Intergenic
1095576294 12:43743897-43743919 GTTATATCTAAGTACTTTGAAGG - Intronic
1098810858 12:75089645-75089667 TTTACAAGTGAGGACTTTGATGG + Intronic
1100374187 12:93997181-93997203 GTTATATATCAGCATTTTGAAGG - Intergenic
1100405774 12:94271941-94271963 GTTACATATGACCGCTGTGATGG + Intronic
1102616504 12:114159218-114159240 ATTACATTTGGGCACTATGGTGG - Intergenic
1104084862 12:125465096-125465118 TTAACATTTGAGGATTTTGAGGG - Intronic
1105108490 13:16574981-16575003 GATACATTTCAGCATTTTGTTGG + Intergenic
1105219500 13:18312574-18312596 ATTTCATTTGAGCACTTGGCTGG - Intergenic
1107415402 13:40195166-40195188 AATACATGTGAGCACTTTCAGGG - Intergenic
1107457411 13:40567592-40567614 GTTACTTGTGTGCACCTTGAGGG + Intronic
1109098744 13:58151311-58151333 GTTACATATGTACACTTTCAGGG - Intergenic
1109211756 13:59543545-59543567 TTTTCATTTGAGCACTATTAAGG + Intergenic
1109322116 13:60823606-60823628 GTTACATTTGTGCAGTTTTTTGG + Intergenic
1110312659 13:74069047-74069069 ATTACATTTGACCACTTGGAGGG - Intronic
1110384969 13:74899473-74899495 GATACAATTGAGCTTTTTGATGG - Intergenic
1112882518 13:104124428-104124450 GTTACATTTCCTCTCTTTGATGG - Intergenic
1113762242 13:112857219-112857241 GTTACATTTAGGCACATAGATGG + Intronic
1114227009 14:20747876-20747898 GTGACACTCGAGTACTTTGAGGG - Exonic
1115323646 14:32113010-32113032 CTTACATTTCAGAACTTTGATGG + Intronic
1116421082 14:44733208-44733230 TTTATATTTGAGTACTTTTAGGG + Intergenic
1116798915 14:49422302-49422324 TTTTGATTTGAGTACTTTGAAGG - Intergenic
1119555275 14:75547983-75548005 CTGCCATTTGAGCACTTTGAGGG + Intergenic
1119852823 14:77878340-77878362 ATTACATACGAGCATTTTGAAGG + Intronic
1120191274 14:81441959-81441981 GTGATATTTGAGGAATTTGAAGG + Intergenic
1120312352 14:82845517-82845539 TTTCCATATGTGCACTTTGATGG + Intergenic
1123227780 15:17062712-17062734 GATATTTGTGAGCACTTTGAGGG + Intergenic
1123703916 15:22937282-22937304 GTTACAGCTGATGACTTTGAAGG + Intronic
1124467525 15:29951580-29951602 GTTACATTTGAGTACATTTTTGG - Intronic
1128433151 15:67619175-67619197 GTTACATGTGAGCAGTATGGGGG - Intronic
1128920639 15:71607055-71607077 GTTCCATTTGGGGCCTTTGAAGG + Intronic
1129415505 15:75375403-75375425 GTTCCTTTTGAGGACTGTGAGGG - Intronic
1129952474 15:79604234-79604256 GTTACTTTAGAGCAATTTGGAGG + Intergenic
1130542151 15:84827954-84827976 GTTATAGTTGAGTAATTTGAAGG + Intronic
1131145322 15:90007458-90007480 GTTACATGTGTGCACTTTTCTGG + Intronic
1136780227 16:32894550-32894572 GTTAAATATGAACTCTTTGAGGG - Intergenic
1137279030 16:46959322-46959344 TTCACATTTAAGCACCTTGATGG - Exonic
1137836666 16:51598572-51598594 GTTTCCTTTGAGGGCTTTGAGGG - Intergenic
1141833444 16:86522675-86522697 GTTACATTTTAGCAAAGTGATGG - Intergenic
1141904058 16:87011392-87011414 GTCACTTTTGAGGACTTTGTTGG - Intergenic
1144342172 17:14318919-14318941 GTTGGTTTTGAGGACTTTGATGG + Intronic
1146328492 17:31907239-31907261 TTTACTTTTAAGTACTTTGAAGG - Intergenic
1147471371 17:40665368-40665390 GTAAAAATTGAGCACTTTGAGGG + Intergenic
1150287256 17:63961361-63961383 GTTCCATATGAGCACTTTGTGGG + Exonic
1164347147 19:27280586-27280608 GTTACATGTGAGCAATGTGCAGG + Intergenic
1164469104 19:28513593-28513615 GTTGCAAATGAGCAGTTTGATGG - Intergenic
1165241813 19:34474869-34474891 GGTCCATTTGACCATTTTGAGGG + Intergenic
1167094815 19:47369531-47369553 GTTACATGTGAGCTCCGTGAGGG - Intronic
925543736 2:4995247-4995269 TTTACATATGAGAACTGTGATGG - Intergenic
926505730 2:13712927-13712949 ATTATCTTTGAGCACTTTCAAGG + Intergenic
934184549 2:89659944-89659966 ATTTCATTTGAGCACTTGGCTGG + Intergenic
935002080 2:99028274-99028296 ATTACATTTGATCCCTTTGCAGG + Intronic
935929519 2:108108744-108108766 GTGACATTTGAACATGTTGAAGG + Intergenic
938721735 2:134073374-134073396 ATTACATTTGAGGGCTTGGAGGG + Intergenic
939035158 2:137122229-137122251 GTTACTTTTGACCTCTTTAATGG + Intronic
939422405 2:141990195-141990217 GCTACATTTCAGCAATTAGAAGG + Intronic
939673040 2:145037348-145037370 GTTACAACAGAGCACTTTTATGG + Intergenic
941063393 2:160873414-160873436 GTGACATTTGAGGAATTTGTCGG - Intergenic
942571292 2:177317156-177317178 GTTACATTTATTCAGTTTGAGGG - Intronic
943146125 2:184047641-184047663 GTTAAATCTGAGCAATTTGGTGG - Intergenic
944696804 2:202208965-202208987 GTTACAATTAAGTAATTTGAGGG - Intronic
944897066 2:204176150-204176172 ATTACATTTGATGACTTTGAAGG - Intergenic
1169248928 20:4045691-4045713 CTTACATCTGAGAACTTTCATGG + Intergenic
1169393883 20:5212990-5213012 CTTTCATTTCAGCACATTGATGG - Intergenic
1170535761 20:17339136-17339158 GTGAAATTTGATCACTTTTATGG - Intronic
1171998356 20:31751193-31751215 GTTAAATTTGAACACTTTCCAGG + Intronic
1174024034 20:47557403-47557425 TTTACAGTTGAGGAATTTGAGGG + Intronic
1174838310 20:53878477-53878499 GTTCCATTTGAGAACTAGGAGGG + Intergenic
1180817102 22:18797434-18797456 ATTTCATTTGAGCACTTGGCTGG - Intergenic
1181203291 22:21231779-21231801 ATTTCATTTGAGCACTTGGCTGG - Intergenic
1181428411 22:22858984-22859006 GTTACAATTGAGCACTCAGCAGG - Intronic
1203223628 22_KI270731v1_random:63645-63667 ATTTCATTTGAGCACTTGGCTGG + Intergenic
1203267201 22_KI270734v1_random:23155-23177 ATTTCATTTGAGCACTTGGCTGG - Intergenic
949380417 3:3439104-3439126 GTTCCTTTTGAGGACTGTGAAGG + Intergenic
953476128 3:43207322-43207344 GTCACATTTGGCCACTTTGAGGG + Intergenic
957390834 3:79566610-79566632 CTTACCATTGAGCACTTTAAAGG + Intronic
957784112 3:84858944-84858966 GTTACATTTTTGTAGTTTGATGG + Intergenic
958704019 3:97630836-97630858 TTTATATTTGAGGACTTGGAAGG - Intronic
959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG + Intergenic
961849579 3:129801987-129802009 GTTAAAAATTAGCACTTTGAAGG + Intronic
962355209 3:134687878-134687900 GTTTCATTTGAGCTATTTGTGGG - Intronic
962773880 3:138640274-138640296 GTTGTTTTTCAGCACTTTGAAGG - Intergenic
963622530 3:147629493-147629515 CTTACATTTTAGCATTTTTAAGG - Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964757259 3:160099505-160099527 GTTTCTTTTGAGCTCTTTGGAGG + Intergenic
965033775 3:163407840-163407862 GTTACAGTTGTGCACTTTTTGGG - Intergenic
966849088 3:184153752-184153774 GTTACATTTGAGGAATAAGAAGG - Intronic
971469494 4:27005809-27005831 GTTTCCTTTGAGCTCTTTTAGGG + Intronic
971931316 4:33087312-33087334 ATTATATTTGAGCACTTGGATGG + Intergenic
973527701 4:51794724-51794746 GTTCCTTTGGAGCGCTTTGAAGG - Intergenic
973527840 4:51796934-51796956 GTTCCTTTGGAGCGCTTTGAAGG - Intergenic
973527978 4:51799145-51799167 GTTCCTTTGGAGCGCTTTGAAGG - Intergenic
973528116 4:51801356-51801378 GTTCCTTTGGAGCGCTTTGAAGG - Intergenic
973528246 4:51803566-51803588 GTTCCTTTGGAGCGCTTTGAAGG - Intergenic
973528380 4:51805776-51805798 GTTCCTTTGGAGCGCTTTGAAGG - Intergenic
973528511 4:51807985-51808007 GTTCCTTTGGAGCGCTTTGAAGG - Intergenic
973528646 4:51810195-51810217 GTTCCTTTGGAGCGCTTTGAAGG - Intergenic
973528737 4:51811728-51811750 GTTCCTTTGGAGCGCTTTGAAGG - Intergenic
974702049 4:65464248-65464270 GCTACATATGGGAACTTTGATGG - Intronic
976431609 4:84967770-84967792 GATATATATGAGCACTTTGTGGG + Intergenic
976881430 4:89930323-89930345 GTTACACTTTAACACTTTTATGG - Intronic
977790887 4:101101744-101101766 GTTACATTTCAGCATTCAGATGG + Intronic
978795357 4:112703171-112703193 GTTCCTTCTGAGGACTTTGAGGG - Intergenic
978912765 4:114083790-114083812 GTGTCATTTGAGCAGTGTGAGGG - Intergenic
981728355 4:147871635-147871657 GTAACATTTGAGCATTTACATGG - Intronic
982230576 4:153205095-153205117 GTACCCTTTGAGCACTTTTATGG - Intronic
984049264 4:174843527-174843549 GTTACCTCTGAGGACTGTGAAGG - Intronic
987458788 5:18180948-18180970 TTTACACTTGAGCAAATTGAAGG - Intergenic
987917728 5:24237411-24237433 ATAACATTTGAACACTGTGATGG - Intergenic
988198375 5:28037742-28037764 GTTACTTTTCAGCACTTTTGTGG + Intergenic
988250408 5:28750091-28750113 GTTAAAATTCAGCATTTTGAAGG + Intergenic
988377376 5:30454624-30454646 TTTATATTTGATGACTTTGATGG - Intergenic
989858788 5:46338023-46338045 TGTACATTGGAGCACTTGGAAGG - Intergenic
989863407 5:46413821-46413843 GTAATTTTGGAGCACTTTGAAGG + Intergenic
992632121 5:78691596-78691618 GAAACATTTGAGCAATTTTATGG + Intronic
992785892 5:80170354-80170376 TTTACTTATGAGCAATTTGAGGG + Intronic
992787105 5:80180987-80181009 TTTACTTATGAGCAATTTGAGGG + Intronic
995775625 5:115722303-115722325 GTTACATTTGAAAACATTAAAGG - Intergenic
996814775 5:127562743-127562765 TTAACATATGAGCATTTTGATGG + Intergenic
998863670 5:146472656-146472678 CTTTCACTTGAACACTTTGAGGG - Intronic
999961276 5:156758330-156758352 TTCACTTATGAGCACTTTGAAGG - Intronic
1000593993 5:163193149-163193171 AATACATTTGGGCACTTTAAAGG - Intergenic
1001685121 5:173588412-173588434 GGTACAATTGAGCAATGTGAGGG - Intergenic
1002080977 5:176737260-176737282 GATCCATTTGAGCAGTTTCAGGG + Intergenic
1003686090 6:8303995-8304017 ATTACATTTGTGGTCTTTGATGG + Intergenic
1003976021 6:11345484-11345506 GCTACATTTGAACACCTTAAAGG + Intronic
1008028653 6:46667900-46667922 GGTACATTTGATCACATTGGGGG - Intronic
1008455229 6:51702995-51703017 CTTACATTTTAGTGCTTTGAGGG - Intronic
1012331956 6:98002514-98002536 GTTACATTGCAGCACTATGGTGG - Intergenic
1012524629 6:100162472-100162494 GTTACTTTTGAGAGCTTTCATGG - Intergenic
1016430801 6:143983281-143983303 GTGACACTTGAGAACTTTGGTGG + Intronic
1017131424 6:151111308-151111330 GTTACCTTTGAGCAATTGAAAGG - Intergenic
1017714978 6:157203298-157203320 GATAAATATTAGCACTTTGATGG - Intronic
1022671884 7:32463365-32463387 GCTAAATTTGACCACTGTGAAGG + Intergenic
1025490300 7:61110027-61110049 GTTCCATTTGAGGCCTTTGGTGG + Intergenic
1025520817 7:61727156-61727178 GTTAATTGTGAGCCCTTTGAGGG - Intergenic
1025545172 7:62156717-62156739 GTTAATTGTGAGCCCTTTGAGGG - Intergenic
1027638337 7:80703382-80703404 GATAGATTTGAGCAATATGAAGG + Intergenic
1029589166 7:101495773-101495795 GTTATGTGTGAGGACTTTGAAGG - Intronic
1030215376 7:107039764-107039786 GTTACATATAAGCAAGTTGATGG + Intergenic
1032253082 7:130274276-130274298 TTTACATTTGAGCTCTTTGGAGG + Intronic
1032434833 7:131891534-131891556 GTTACATTTGAGTTCTTGGCAGG + Intergenic
1035192779 7:157186785-157186807 GTTCCAGTTGAGCACATTTATGG + Intronic
1037619613 8:20551856-20551878 TTTACAGTTGAGAAATTTGAGGG + Intergenic
1038698004 8:29823405-29823427 GTTAGATTTGAGGACTAGGATGG - Intergenic
1042330773 8:67578360-67578382 GTTACATTTGAGCACTTTGAGGG - Intronic
1042506211 8:69563635-69563657 TTTACATTTGAGCTCTGTGTTGG + Intronic
1047234936 8:123032619-123032641 GTTTTATTTTAGCACTTTCAAGG + Intronic
1047862593 8:128984710-128984732 GTTAAATATGAGCATTTTGCAGG + Intergenic
1050089039 9:1997934-1997956 GTTACATTTGAGATCCCTGATGG - Intergenic
1056062525 9:82898302-82898324 GGTAAATTTGAGCAGTTTGAGGG + Intergenic
1056934965 9:90909476-90909498 GTTACTTTTGAACACTTTAACGG + Intergenic
1057405745 9:94769233-94769255 GCTACATTTTAGCAGTGTGAAGG - Intronic
1058498449 9:105586091-105586113 CTTACTTTTGACCATTTTGAGGG + Intronic
1059996354 9:119913885-119913907 GTTAGATTTGAGCACATGGCTGG - Intergenic
1203417378 Un_KI270340v1:901-923 GTTCCTTTGGAGCGCTTTGAAGG + Intergenic
1186862907 X:13690824-13690846 GTTACAGTTGAGGAATTTGGGGG + Intronic
1190633288 X:52410486-52410508 GCTATATTTGACCACTTTCATGG + Intergenic
1190681283 X:52829328-52829350 GCTATATTTGAGCACTTCCATGG + Intergenic
1190998447 X:55635718-55635740 GCTATATTTGAGCACTTCCATGG + Intergenic
1191570403 X:62608565-62608587 GTTCCCTTTGAGGACTATGATGG + Intergenic
1192698539 X:73444075-73444097 CTGAAATTTGAGCACCTTGAAGG - Intergenic
1192753676 X:74022429-74022451 GTTATATTTTAGCATTTTTATGG - Intergenic
1192775037 X:74235212-74235234 ATTACATTTTAAAACTTTGAAGG + Intergenic
1194805004 X:98316378-98316400 GTTACATTTCAGCGGTTTCAAGG + Intergenic
1195024823 X:100866081-100866103 GTTACATGTGCGAACTTTCATGG - Intronic
1195340892 X:103905024-103905046 GTCACACATGAGCACTTTGAAGG + Intergenic
1197430439 X:126356150-126356172 CTTAGATTTGTCCACTTTGATGG - Intergenic
1201573432 Y:15437526-15437548 GTTACCTTTAAGCATTTTGTGGG - Intergenic