ID: 1042330793

View in Genome Browser
Species Human (GRCh38)
Location 8:67578508-67578530
Sequence CCAATTTGGCACGAGATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042330790_1042330793 -10 Left 1042330790 8:67578495-67578517 CCATGGGCACAACCCAATTTGGC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1042330793 8:67578508-67578530 CCAATTTGGCACGAGATCCCTGG No data
1042330788_1042330793 1 Left 1042330788 8:67578484-67578506 CCAGTGCAGCACCATGGGCACAA 0: 1
1: 0
2: 1
3: 15
4: 156
Right 1042330793 8:67578508-67578530 CCAATTTGGCACGAGATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042330793 Original CRISPR CCAATTTGGCACGAGATCCC TGG Intronic
No off target data available for this crispr