ID: 1042334659

View in Genome Browser
Species Human (GRCh38)
Location 8:67617592-67617614
Sequence CAGCCAGCATACCAAGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042334656_1042334659 28 Left 1042334656 8:67617541-67617563 CCTCACTTTTACCTTTTATGAAG 0: 1
1: 0
2: 0
3: 23
4: 359
Right 1042334659 8:67617592-67617614 CAGCCAGCATACCAAGCCACTGG No data
1042334657_1042334659 17 Left 1042334657 8:67617552-67617574 CCTTTTATGAAGTATCATTCATA 0: 1
1: 0
2: 3
3: 26
4: 249
Right 1042334659 8:67617592-67617614 CAGCCAGCATACCAAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042334659 Original CRISPR CAGCCAGCATACCAAGCCAC TGG Intronic
No off target data available for this crispr