ID: 1042335738

View in Genome Browser
Species Human (GRCh38)
Location 8:67628532-67628554
Sequence CAGTGGCTACAAAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 357}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042335738 Original CRISPR CAGTGGCTACAAAGGGAAGA TGG (reversed) Intronic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905403317 1:37718010-37718032 CAGTGGGTACAAATGGCAGTAGG + Exonic
905503685 1:38459520-38459542 CAGTGGCCACCAAAGGAAGTTGG - Intergenic
905578795 1:39067689-39067711 CAGTGGCTGCCAAGGAATGAGGG - Intergenic
906060777 1:42947114-42947136 CAGTGGCTAGAACTGGAACATGG + Intronic
906296532 1:44652195-44652217 CAGTAGCTACACTGGGATGATGG - Intronic
906313943 1:44774214-44774236 CAGAGGCTAGAAAGGGTAGTGGG + Intergenic
906806645 1:48785519-48785541 CAGTGGTTGCTAAGGGAAAATGG - Intronic
907718563 1:56950599-56950621 CAGCCGCTACAAGGGGAAGGAGG + Intronic
908748182 1:67395673-67395695 AACTGGCCACAAAGGGAAAAAGG + Exonic
909681251 1:78294487-78294509 CTGTGGCTTCAGAGGGTAGAAGG + Intergenic
912501901 1:110128358-110128380 CTGTGGCTAGAACAGGAAGAAGG + Intergenic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
914430439 1:147615944-147615966 CAGTGACTGCAAAGGAAAGGAGG + Intronic
915066665 1:153230709-153230731 CAGTGGAGACAAAGACAAGAGGG + Intergenic
915099398 1:153488092-153488114 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG + Intergenic
916339187 1:163709932-163709954 CAATGGCTTCAGAGGGAAAAGGG - Intergenic
917477421 1:175380671-175380693 CAGTTGCCACAAAGAGACGACGG + Intronic
917598086 1:176550014-176550036 CAGTGGTTACTAAGGGCTGAAGG - Intronic
919701515 1:200636192-200636214 TAGTGGCTCCAAGGTGAAGAAGG - Intronic
920997806 1:211011793-211011815 CAGAGGCTTCACATGGAAGACGG - Intronic
921817740 1:219583024-219583046 TAGAGGCTACAAAGGGTAGAGGG - Intergenic
922285741 1:224169053-224169075 CAGAGGCTAAAAAGGGACAAAGG - Intergenic
924149247 1:241111114-241111136 AAATGGCTACAAAGAGAAGCTGG - Intronic
1063113935 10:3060093-3060115 CAGTGGCTGGCAAGGAAAGAAGG + Intergenic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1064460448 10:15530010-15530032 CACTGGCTACCAAGGGATGAAGG + Intronic
1065056895 10:21854095-21854117 CAGTGGATACAAAGATAAAAAGG + Intronic
1065617995 10:27548537-27548559 CAGAGGCTGGAAAGGGAAGATGG + Intergenic
1065757071 10:28940593-28940615 CAGTGAGTACAAAGGGAGCAAGG + Intergenic
1065785208 10:29206635-29206657 CAGAGGGTACACAGGTAAGAGGG + Intergenic
1065810049 10:29433888-29433910 CAGAGGCTAGAAAGGGTAGTAGG - Intergenic
1065965458 10:30766918-30766940 CTGTGGCCACAAAGGAAAGATGG - Intergenic
1066497886 10:35959908-35959930 GAGTGGCTAGAAAGGAAGGAAGG - Intergenic
1066685184 10:37975096-37975118 CAGAGGCTGCGAAGGGAAGTAGG + Intronic
1068542432 10:58310336-58310358 CAGAGGCTAGGAAGGGAAGTGGG + Intergenic
1068572042 10:58640488-58640510 AAGAGGTCACAAAGGGAAGAAGG - Intronic
1068786255 10:60978382-60978404 TAGTAGTTACAAAGGGAACATGG + Intronic
1068932975 10:62610499-62610521 CAGAGGCTGCAAAGGGAGAAGGG - Intronic
1069515492 10:69073750-69073772 CAGTTCCCACAAAGTGAAGATGG - Intergenic
1071180549 10:82978747-82978769 CAGTGTCTCCAAAGGTAAAATGG + Intronic
1071492280 10:86144018-86144040 CAGTGAGTACTAGGGGAAGAAGG - Intronic
1071713610 10:88073797-88073819 CGGTGGCTACAAGGGGAAGGTGG - Intergenic
1073039724 10:100595036-100595058 CAGTGGCTACGAAGGGAGTGAGG + Intergenic
1073323505 10:102629575-102629597 CAAAGGCTCCAAAGGGAAGGAGG - Intronic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1075725140 10:124607134-124607156 CAGTGGGTACAGAGCGGAGAGGG - Intronic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077445104 11:2587161-2587183 CAGTGGCCACACAGTGAGGAAGG - Intronic
1077938232 11:6813154-6813176 CAGTGGCTGGAAATGGATGAGGG - Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081208690 11:40305159-40305181 CAGTGCCTGCAAAGAGCAGAGGG - Intronic
1081415916 11:42815900-42815922 AATTGTCTACATAGGGAAGAGGG - Intergenic
1081710417 11:45212420-45212442 AAGTGGTTACAAAAGGGAGAAGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1084912734 11:72404265-72404287 CAGTGCCAAGAAAGGGAGGAGGG + Intronic
1085440602 11:76559176-76559198 CAGTTGCTGGAAAGGGAAGTGGG + Intergenic
1087190067 11:95244875-95244897 CAGTGGCATCACAGGTAAGAAGG + Intergenic
1088410361 11:109527181-109527203 GAGTGGCTGCAAAGGAAAAAAGG - Intergenic
1089287877 11:117419452-117419474 TTGTAGCTACAAAGAGAAGATGG + Intergenic
1089788905 11:120928288-120928310 CTCTGGCTGCAACGGGAAGAGGG + Intronic
1092107465 12:5932355-5932377 AAGTGACTAAAAAGGAAAGAAGG + Intronic
1093549676 12:20392960-20392982 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1094201152 12:27795783-27795805 TAATAGCTATAAAGGGAAGAAGG + Intronic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1095304832 12:40626884-40626906 CAGTGGCTTCAATAGGTAGAGGG - Intergenic
1095494159 12:42767512-42767534 CAGTGCCTTTAAAGGGAAGGTGG + Intergenic
1096421885 12:51465741-51465763 AAGGGGCTACAATGGGAGGAAGG - Intronic
1097440821 12:59605739-59605761 GACTGGCTACATAGAGAAGATGG - Intronic
1098569939 12:71976952-71976974 CAGTGGTTACAAGGGGCAGGAGG + Intronic
1098996021 12:77120891-77120913 AAGTAGCTACAATGGGCAGAGGG + Intergenic
1099980093 12:89589338-89589360 CAGAGGCAAAAAAGAGAAGAAGG + Exonic
1100854597 12:98747935-98747957 CAGAGGCTGGAAAGTGAAGAAGG + Intronic
1102005863 12:109588889-109588911 CAGAGGCTACAAAGAGAAGGAGG + Intronic
1102428815 12:112865563-112865585 CAGGTGCTGCACAGGGAAGAAGG - Intronic
1104017720 12:124971691-124971713 CAGTGGCTTCAAAGCCAGGAGGG + Intronic
1106780530 13:33055030-33055052 TGATGGCTGCAAAGGGAAGAGGG - Exonic
1106818036 13:33430899-33430921 CAGAGGCTACAAAGGATAGAAGG + Intergenic
1107066650 13:36220618-36220640 CAGTGGCTACTAAGAAAAAATGG + Intronic
1107232102 13:38122275-38122297 CCATGGATACTAAGGGAAGATGG - Intergenic
1108044262 13:46368033-46368055 CAGTGGCTATGAAGGCAAGTTGG - Exonic
1108436541 13:50406558-50406580 GAGTGGGTACAAAAGGGAGAAGG + Intronic
1109797231 13:67331683-67331705 AAGTGGCTCCAAAGGGAAGGGGG - Intergenic
1111057221 13:82967177-82967199 CATGGGATACAAAGGGAAGGAGG + Intergenic
1111300009 13:86336707-86336729 CAGTGGTTACCAGGGTAAGAGGG + Intergenic
1111829712 13:93311876-93311898 CTGAGGGTACAAAGGCAAGATGG + Intronic
1112065805 13:95791383-95791405 CAGTGCCTACAAGTGTAAGAAGG + Exonic
1113432362 13:110261922-110261944 CAGTGGCTGCACAGGGCAGGTGG + Intronic
1116195657 14:41722588-41722610 GAGTGGGGACAAAGGGAAAAGGG - Intronic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116494080 14:45539413-45539435 CAGTGGCTAGGAAGAGTAGAGGG - Intergenic
1118035582 14:61862775-61862797 CAGGGGTTAGAAAGGGTAGAAGG - Intergenic
1118538509 14:66795984-66796006 CAGAGGCTAGGAAGGGTAGAGGG - Intronic
1119106015 14:71924558-71924580 CAGTGGTTACCAAGGGCAGGTGG - Intergenic
1119182532 14:72614462-72614484 CAGTAGCTGGGAAGGGAAGAGGG - Intergenic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1121021263 14:90581513-90581535 CAGTGGCAACACAGGGGAGCAGG + Intronic
1122128304 14:99591016-99591038 CAGCCGCTGCCAAGGGAAGACGG + Intronic
1125637718 15:41203413-41203435 GAGTCTCAACAAAGGGAAGAGGG - Intronic
1125778764 15:42244162-42244184 CATTGCCTAGAAAGGGAAAAGGG + Exonic
1126216126 15:46157114-46157136 CAGCTGCTACTAAGGGATGAGGG - Intergenic
1127230385 15:56985958-56985980 GAGTGGACAGAAAGGGAAGAGGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127808964 15:62546711-62546733 CAGTGGCCACACAGCGAAGGCGG + Intronic
1131577000 15:93602227-93602249 TAGAGGCTGCAAAGGGAAGATGG - Intergenic
1131831380 15:96356856-96356878 CAGTGGCTGCATTGGGATGAAGG - Intergenic
1132071850 15:98785359-98785381 CATATGCTACAAAGGGAAGAGGG - Intronic
1132222054 15:100112382-100112404 CAGAGGCCTCAAAGGGGAGACGG - Intronic
1132997912 16:2832896-2832918 AAGTGGAGACAAAGGGAGGAGGG + Intronic
1133046986 16:3093598-3093620 CAGTGGCTACATCAGGAAGAAGG - Intronic
1133419532 16:5634105-5634127 CAGTGGCTATAAAAGGTAAAGGG - Intergenic
1133558224 16:6925634-6925656 TAGTGGCTACAAAGGGCTTAGGG + Intronic
1134317413 16:13131868-13131890 CAGTGGTTAATAAGGGAGGATGG - Intronic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1135267486 16:21040050-21040072 CAGTGACAATAAAGGCAAGAAGG + Intronic
1137405934 16:48189340-48189362 TGGTGGCGACAAAGGGAAAATGG + Intronic
1137752313 16:50875632-50875654 CAGAGGCTACAAAGTGTAGGGGG - Intergenic
1139908484 16:70382018-70382040 CAAGGGCTGCAAAGGGAAGGTGG - Intronic
1141748883 16:85945129-85945151 CAGAGGCTCCAAATGGGAGATGG - Intergenic
1143447528 17:7018212-7018234 GAGTTCCTACAGAGGGAAGATGG - Intergenic
1144213088 17:13031690-13031712 CAGTGGCCAGGAAGGTAAGATGG + Intergenic
1146308893 17:31751842-31751864 CAGTGGTTACCAAGGGCTGAAGG + Intergenic
1147426511 17:40348299-40348321 CAATGGCTAGAGAGAGAAGAGGG - Exonic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1149064208 17:52460821-52460843 CAGTATCTTCAAAGGAAAGAAGG + Intergenic
1149066810 17:52490254-52490276 TAGTGGCAACTCAGGGAAGAGGG + Intergenic
1149687090 17:58542223-58542245 CTCTGGCTACAAAGTGGAGAGGG - Intronic
1151189211 17:72385917-72385939 TAGTCTCTACAAAGGGAACATGG - Intergenic
1152645579 17:81467114-81467136 CTGTGGCAAGAAAGGAAAGACGG + Intergenic
1155295842 18:24384013-24384035 CAGTGGCTGCACAGAGGAGAAGG + Intronic
1156936360 18:42713747-42713769 GTTTGGCTACAAAGAGAAGAGGG - Intergenic
1157593133 18:48848113-48848135 CAGTGGAGACAAAGGGGACAGGG - Intronic
1157593198 18:48848391-48848413 CAGTCGCTACCAAAGGAAGGAGG + Intronic
1158568121 18:58572698-58572720 CAGGGGCTACCAAAGGGAGAGGG + Intronic
1159237128 18:65691052-65691074 CAGAGGCTAGGAAGGGTAGAAGG + Intergenic
1159454896 18:68648908-68648930 CAGTGGTTACTAGGGGATGAGGG + Intergenic
1160370176 18:78365562-78365584 CAGTGGCTCCAAGGAGAAGAGGG + Intergenic
1160425764 18:78778132-78778154 CAGTGGCCACTCAGAGAAGATGG + Intergenic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1161668006 19:5588697-5588719 CTGTGGCTACCAAGGGCAGGGGG + Intronic
1163497867 19:17657084-17657106 CTGTGGCTTCCAAGGGAAGCAGG - Intronic
1163585308 19:18160712-18160734 GAGTGACTCCTAAGGGAAGATGG + Intronic
1163721730 19:18901096-18901118 AGGTGGCTCCAAAGGGAAGTGGG + Intronic
1164703489 19:30302911-30302933 CAGGGGGTAAAAAGGGATGAAGG - Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165292677 19:34900939-34900961 CAGTGGCTTCCAAGGGTTGAAGG + Intergenic
1166033846 19:40153089-40153111 CAGTGGCTACCCAGGGGAGCAGG + Intergenic
1166441672 19:42820971-42820993 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166449806 19:42888959-42888981 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166461111 19:42989257-42989279 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166478400 19:43149241-43149263 CTGGAGCTAGAAAGGGAAGAAGG + Intronic
1166501059 19:43341549-43341571 CTGCAGCTAGAAAGGGAAGAAGG + Intergenic
1166509041 19:43391903-43391925 CTGCAGCTAGAAAGGGAAGAAGG - Intergenic
925043590 2:753219-753241 AAGTGGATACAAGGTGAAGAGGG + Intergenic
926507145 2:13731261-13731283 CAGTGACTCCAAAAGGGAGAAGG - Intergenic
927039695 2:19215983-19216005 CTGTGACCACAAATGGAAGAAGG - Intergenic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
930560888 2:52958632-52958654 CAGAGGCTACGAAGGGAATTTGG + Intergenic
931104383 2:59038960-59038982 CAGAGGCTAGGAAGGGTAGAGGG + Intergenic
932287139 2:70544861-70544883 CAGAGGCTAGAAAGGGTAGTGGG + Intronic
932447456 2:71789624-71789646 CAGAGGCTTCATGGGGAAGATGG + Intergenic
932474750 2:71996040-71996062 CAGTGGCTTCAAGTAGAAGATGG + Intergenic
933711597 2:85330170-85330192 CAGAGGCTGGGAAGGGAAGATGG + Intergenic
933811091 2:86033192-86033214 CAGTGACAAAAAGGGGAAGAGGG - Intronic
934780126 2:96964691-96964713 CAGTAGCTGAAAAGGGAAGTGGG - Intronic
936260128 2:110952277-110952299 CAGGGGCTAAAAAGAGAAAAGGG - Intronic
937064612 2:119008195-119008217 TAGTGGATACAAAGGCAAGCAGG + Intergenic
939331236 2:140764348-140764370 CAGTGGTTACAAATGCACGACGG + Intronic
939399504 2:141672364-141672386 GAGTGTTCACAAAGGGAAGAAGG + Intronic
939683422 2:145167927-145167949 CAGAGGATACACTGGGAAGATGG + Intergenic
941086861 2:161127959-161127981 CATAGGCTACAAGGGGAAAAAGG + Intergenic
943475748 2:188353529-188353551 CAGTGACTACAATGGGTAGATGG - Intronic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
944517623 2:200527994-200528016 GAGTTGATACAAAGGGAAGAAGG + Intronic
945248421 2:207742544-207742566 CAGTTGCTACAAAAGGCAGCCGG + Intronic
945547381 2:211173322-211173344 CAGGGAGTACAAAGTGAAGAGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946269379 2:218577693-218577715 CAGTGGTTACCAGGGCAAGATGG + Intronic
946325617 2:218983357-218983379 CAGTGGCTGAAAAAGTAAGAGGG - Intronic
947090017 2:226499117-226499139 TAGTAGCAAGAAAGGGAAGATGG + Intergenic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171428773 20:25065480-25065502 AAGAGGCTACAAGGGGGAGAGGG + Intergenic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1175628746 20:60513187-60513209 CATTGACTGCAAAGGGAACAGGG - Intergenic
1175628763 20:60513269-60513291 CATTGACTGGAAAGGGAAGAGGG - Intergenic
1175629310 20:60519913-60519935 CAGTGTCTACATAGGGCTGATGG - Intergenic
1175999310 20:62824973-62824995 CACTGGCTACAAAGGCGAGCAGG + Exonic
1176100526 20:63362371-63362393 CAGTGGCTGCTCAGGGAAGCTGG - Intronic
1178231604 21:30791303-30791325 CAGTTGCTATAAATTGAAGAGGG + Intergenic
1178797521 21:35758630-35758652 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1180615307 22:17122165-17122187 CAAAGGCTCCAAAGGGATGATGG + Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1181024345 22:20119400-20119422 CAGTGGCAAAAAAGGGCAGTGGG - Intronic
1181078498 22:20397549-20397571 TAGTGGTTACCAAGGGGAGAGGG - Intronic
1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG + Intronic
1182304463 22:29358357-29358379 CAGTGACTAGAAGGGGAAGGAGG + Intronic
1183214323 22:36469319-36469341 CAGTGGCTACAGAGGGCACAAGG + Intronic
951219816 3:20057201-20057223 CAGTGCCAACAAAGGGAATAGGG + Intronic
952493157 3:33891373-33891395 CACTGGCTACAAAGGAGAGGAGG - Intergenic
954910019 3:54096720-54096742 GAGAGGCTCCAAAGGGAAGGCGG + Intergenic
955817724 3:62863408-62863430 CAGTGACTACACAGGGTAAAGGG + Intronic
957280497 3:78145171-78145193 CAGAGGCTAGAAAGGGTAGTGGG - Intergenic
958673752 3:97238809-97238831 CAGTAGGTACAAAGGCAAAAGGG + Intronic
960320847 3:116233624-116233646 CAGAGGCTGGAAAGGGAAGTAGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961341477 3:126224935-126224957 CGGTGGTGACCAAGGGAAGAAGG + Intergenic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
965048010 3:163604123-163604145 CAGAGGCTGGAAAGGGAAGTGGG + Intergenic
966098275 3:176232972-176232994 CAGTGGTTACCAAGGGTAGAAGG + Intergenic
966137360 3:176714080-176714102 CAGAGGCTTCCAAGGGAAGATGG + Intergenic
966250804 3:177863393-177863415 CAGAGCCTACACAGGGAAGGAGG - Intergenic
966399384 3:179532873-179532895 CAGTGGTTACCAGGGGAAGGAGG - Intergenic
967062506 3:185884623-185884645 TAGGAGCTACAAAAGGAAGAAGG + Intergenic
967063227 3:185891058-185891080 TTGTGGCTACAAGAGGAAGATGG + Intergenic
967753479 3:193141534-193141556 CAATGGGTACATATGGAAGAAGG + Intergenic
967967949 3:194976980-194977002 AGTTGGCTACAAAGGGCAGAAGG - Intergenic
968452048 4:680441-680463 CCGTGGCTGCCAAGGGCAGATGG - Intronic
969892945 4:10276564-10276586 CAGTAGCCACAAAGGAAAGCGGG - Intergenic
971335560 4:25720581-25720603 CAGCGGCTTCAAAGGGAAAGCGG + Intergenic
972561396 4:40232030-40232052 AAGTGCCAACAAAGGGAAAAAGG - Intronic
972950962 4:44321757-44321779 CAGAGGCTACAAAGGAAAGGAGG - Intronic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973176268 4:47209883-47209905 CAGAAGCTACAAAGGGTATAGGG - Intronic
973558030 4:52105746-52105768 CAGTGGCTACAAGGGAGAAAGGG - Intergenic
973878388 4:55243563-55243585 CAATGGTTACAAAGTTAAGATGG + Intergenic
973967118 4:56174443-56174465 CAGAGGCTAAGAAGGGAAGCAGG - Intronic
974417350 4:61627077-61627099 CAGAGGCAATAAAGGGTAGAGGG - Intronic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
975296326 4:72738487-72738509 CAGTAGCTACAAAGGGCTGGGGG - Intergenic
975323600 4:73035915-73035937 CAGAGGACACACAGGGAAGAAGG - Intergenic
976886970 4:89997428-89997450 CATTGGCTTCAAAGGGAATTTGG + Intergenic
977044966 4:92058086-92058108 CAGTGGCTAAGAAGGGAGTAGGG + Intergenic
977662233 4:99603231-99603253 CAGTGGAGACACAGGAAAGATGG + Intronic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
978781683 4:112562208-112562230 CAGTGGTTAAAAAGAGAAAAGGG - Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
979539470 4:121865049-121865071 TAGAGGCTGCAAAGGGTAGAGGG - Intronic
980710383 4:136558618-136558640 CACTTGCTACATAGGGAAAAAGG - Intergenic
982176814 4:152713443-152713465 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
983369471 4:166840447-166840469 CTTTGGCTACAAAGAGAAAAGGG + Intronic
984673678 4:182522340-182522362 CAGTGGCTGCAAAGTGAAAGCGG - Intronic
984874502 4:184355194-184355216 CAGGGGCAACACAGCGAAGAAGG + Intergenic
988188292 5:27896928-27896950 GGGTGGTTACAAATGGAAGAGGG + Intergenic
988885063 5:35547735-35547757 CAGTGCCCACACAGAGAAGAGGG - Intergenic
989445259 5:41520672-41520694 CAATGGCTACAAAGGGGATTGGG + Intergenic
990590235 5:57255096-57255118 TAGTGGCTTCAAATGGCAGAGGG - Intronic
990700468 5:58469626-58469648 CAGAGGCTACGAAGGGTAGTGGG - Intergenic
991012069 5:61893807-61893829 CAGTGGCCAGAAAGGGAGAAAGG - Intergenic
991906571 5:71519463-71519485 CAGAGGCTAGGAAGGCAAGAGGG - Intronic
992625015 5:78628787-78628809 TTGTGGCCATAAAGGGAAGAAGG + Intronic
993094600 5:83466738-83466760 CATTGACTACAAATGGATGAAGG - Intergenic
993590807 5:89793271-89793293 CAGTGGTTACCAAGGGAGCAAGG + Intergenic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
994626463 5:102226252-102226274 CAGTGTCTGCCAAGAGAAGATGG - Intergenic
995858069 5:116614647-116614669 AAGGGCCTACAATGGGAAGAGGG - Intergenic
997109987 5:131064491-131064513 CAGTGGCTAGAAAGGCAGGTAGG + Intergenic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
999409774 5:151340577-151340599 GAGTGGCTAGAAAGGTAGGAGGG + Intronic
999551877 5:152696628-152696650 CAGAGGCTGGAAAGGGGAGAGGG - Intergenic
1000407767 5:160906899-160906921 CAGTGGCTTAAAAGGGCAGAGGG - Intergenic
1001499060 5:172214409-172214431 CAGAGGCTAAACAGAGAAGAGGG - Intronic
1001929957 5:175665778-175665800 GAGTGGTTAGAAAAGGAAGAAGG + Intronic
1003515683 6:6816642-6816664 TAGTTGCTACAAAGAGAAAAGGG + Intergenic
1003565640 6:7219921-7219943 CAGTTGATACTAAGGGAGGAAGG + Intronic
1004947834 6:20635342-20635364 CAGGGACTACAAAGGAAGGAAGG - Intronic
1005036639 6:21561389-21561411 CAGAGGCTACGAAGGGCAGTGGG - Intergenic
1005302172 6:24481681-24481703 CAGCAGCCACAAGGGGAAGAGGG - Intronic
1005316105 6:24604268-24604290 CAATGGCTGCAGATGGAAGATGG - Intronic
1005572387 6:27157780-27157802 CTTTGGCAACAAAAGGAAGAGGG - Intergenic
1007777994 6:44234447-44234469 CAGTGAAGACAAAGGAAAGATGG - Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009676255 6:66826259-66826281 CAGTGGCTTCAGACAGAAGATGG + Intergenic
1010722689 6:79301728-79301750 CAGTGGCAAAAATGGGAAAAAGG - Intergenic
1011278939 6:85657541-85657563 CAGTGGATACAAATGAAAGCTGG + Intergenic
1011757098 6:90510845-90510867 CATTGCCGCCAAAGGGAAGAGGG - Intergenic
1014131530 6:117839874-117839896 CAGTGTCTACAGGGGGAAAAGGG + Intergenic
1014402127 6:121003216-121003238 CAGAGGCTGCAAAGGGTAGTGGG + Intergenic
1014976399 6:127890420-127890442 CAGAGGCTAGAAAGGGTAGCGGG + Intronic
1015224308 6:130838978-130839000 CAGTGGACACAAAGTAAAGAAGG + Intergenic
1015584671 6:134763350-134763372 CAATGGGTAGAAAGGGCAGATGG + Intergenic
1015713627 6:136167816-136167838 GAGTGGATACAAAAGGAACAAGG + Intronic
1015726623 6:136306046-136306068 CACTGGCTCCAAAGGAAAGAGGG - Intergenic
1016893391 6:149029216-149029238 CAGTGGAGACTAGGGGAAGAGGG + Intronic
1017071068 6:150576039-150576061 CAGTGTCTACACGAGGAAGATGG + Intergenic
1017739071 6:157389768-157389790 CAGTGGGTACAAAGGGTGGAAGG - Intronic
1018442458 6:163825611-163825633 CAGTGGCATCAAATAGAAGATGG + Intergenic
1019272090 7:156133-156155 CACTGGCTACGGCGGGAAGAGGG - Intergenic
1020257508 7:6510340-6510362 CAGCAGCTTCAAAGGGAAGATGG - Exonic
1021748948 7:23775572-23775594 CAATTGCTACAAAGGGAATAAGG - Intronic
1022355804 7:29613345-29613367 ATTTGGATACAAAGGGAAGAAGG + Intergenic
1023719682 7:43079843-43079865 CAAAGGCTGGAAAGGGAAGAAGG + Intergenic
1023781422 7:43659635-43659657 CAGTGACTACAAAAGGAATCTGG + Intronic
1023981157 7:45070968-45070990 CAGCAGCAAGAAAGGGAAGAAGG - Intronic
1024285387 7:47752897-47752919 CAGAGGCTAGAAAGGGTAGTGGG - Intronic
1027802587 7:82774133-82774155 GAGCTCCTACAAAGGGAAGAAGG - Intronic
1028124059 7:87091198-87091220 CAGTGGCTACAAAAAGTAAAAGG + Intergenic
1028935675 7:96461507-96461529 CAGAGGCTAGAAAGGGGAGCGGG - Intergenic
1029123905 7:98284759-98284781 AAACGGCTAGAAAGGGAAGATGG - Intronic
1029396000 7:100309008-100309030 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029396223 7:100310394-100310416 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029396449 7:100311784-100311806 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029396673 7:100313174-100313196 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029396898 7:100314566-100314588 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029919043 7:104242859-104242881 CAGTGGCCACAGAGGAGAGAAGG + Intergenic
1031201913 7:118699255-118699277 CAGTTTCTACAAAGGGCAAACGG + Intergenic
1031996691 7:128236946-128236968 AAGTGGCTACACAGAGAAAAGGG - Intergenic
1034042026 7:147887660-147887682 CAGTGGCTATATGAGGAAGAAGG + Intronic
1034235196 7:149561420-149561442 CAGTAGCTACAAGGGAAAGTGGG + Intergenic
1035582120 8:747009-747031 CAGTGGCTAGGAAGGGAAATGGG + Intergenic
1035696827 8:1604110-1604132 CAGTGTCCACAAAATGAAGAAGG - Intronic
1037251460 8:16900159-16900181 CAATGCAAACAAAGGGAAGAAGG + Intergenic
1038933859 8:32225783-32225805 CAGTGTCTAAAAACTGAAGATGG + Intronic
1039038603 8:33385514-33385536 CACAGGCTCCTAAGGGAAGAGGG + Intronic
1039246771 8:35617257-35617279 AATTGGCTAAAAAGGAAAGAAGG - Intronic
1039635799 8:39163330-39163352 CAGGGCCCACAAAGGGAAGGAGG + Intronic
1039848386 8:41342314-41342336 GAGTGGCTTCAAAGGGTTGAGGG - Intergenic
1039947840 8:42145320-42145342 CAATGGCTACAAAGGTGAGCAGG + Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040669771 8:49675928-49675950 AATTGTCTACAAAGGGAAGCTGG - Intergenic
1041513791 8:58677595-58677617 TAGTGGCCTCAAAAGGAAGAGGG + Intergenic
1042051614 8:64715646-64715668 CACTGGCAACAGAGGGAAAATGG + Intronic
1042117440 8:65447551-65447573 CTGTGGCTACAAGGGGCAAAGGG + Intergenic
1042283198 8:67077799-67077821 CAGTGGATACAAGGGGATGCCGG + Intronic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1043829950 8:84975982-84976004 TAGAGGCTAGAAAGGGTAGAAGG + Intergenic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044834050 8:96278604-96278626 CAGTTGCTATAATGGGATGAAGG - Intronic
1045235527 8:100349866-100349888 GAGAGGGTACAAAGGGGAGACGG + Intronic
1045606078 8:103778410-103778432 CAGAGGCCAGAAAGGGCAGAGGG - Intronic
1046512866 8:115221365-115221387 CAGTGGTGACAAGGAGAAGAGGG - Intergenic
1047045200 8:121045543-121045565 CAGGGGCTTCCAAGTGAAGAGGG - Intergenic
1048672803 8:136742039-136742061 CAGTGACTACTATGTGAAGAAGG + Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049801368 8:144518950-144518972 CAGTGGCTCTCCAGGGAAGAGGG + Intronic
1051034880 9:12732304-12732326 CAGTGGCTGCAAAGGATATAGGG + Intergenic
1051470173 9:17430704-17430726 CAGAGGCTACAAAGGGTGGCAGG - Intronic
1051621751 9:19057408-19057430 TAGTGGCTTCAGAGGGAACATGG + Intronic
1055746471 9:79451238-79451260 CAGTGGCTTGATAGGAAAGAGGG - Intergenic
1056040061 9:82656128-82656150 CAGAGGCTGGGAAGGGAAGAAGG + Intergenic
1057081790 9:92178995-92179017 GAGTGGAGACAAAAGGAAGAAGG + Intergenic
1057700453 9:97360175-97360197 CAGTAGAGCCAAAGGGAAGAGGG + Intronic
1059235464 9:112757155-112757177 TAGTGGCTACCAAGGGCAGGTGG - Intronic
1059503426 9:114776431-114776453 AAGTGGCTGCAGAGGGAAGTGGG + Intergenic
1060185716 9:121562955-121562977 CCCTGGCTACAAGGGGAAGGTGG - Intergenic
1062654074 9:137593103-137593125 CAGTGGCTGGAAAGGGATGGGGG - Intergenic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1186380860 X:9057296-9057318 CAGGGTCTACAAAGCAAAGACGG - Intronic
1187178770 X:16922322-16922344 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
1187244150 X:17538894-17538916 CAGTGGCTAGACAGGGAAGCAGG - Intronic
1188080246 X:25829784-25829806 AAGTGGATTCAAAAGGAAGACGG - Intergenic
1188707311 X:33351296-33351318 CAGTGGCTGCCTAGGGAAGGTGG + Intergenic
1189081608 X:37978837-37978859 TACTGGCTATAAAGGGGAGAAGG + Intronic
1189384874 X:40529086-40529108 CAGAGGCTGGAAAGGGTAGAGGG + Intergenic
1190152637 X:47960637-47960659 CACTGCCCAAAAAGGGAAGAGGG + Intronic
1190428396 X:50354164-50354186 GAGTGGCTACAGAGGTAAGTAGG + Intergenic
1190736995 X:53262303-53262325 CAGTGCCAATAAAGGGAAGGAGG - Intronic
1191130520 X:57003563-57003585 CAGAGGCTACAAAGGGAAGTGGG - Intergenic
1191687923 X:63911635-63911657 CAGTGGCTGCCAAGGGAAAAAGG + Intergenic
1192128283 X:68523050-68523072 CATTGCCTACTCAGGGAAGAGGG - Intronic
1193527536 X:82612057-82612079 CTGAGGCTGCAAAGGGCAGAGGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1195949396 X:110251605-110251627 CAATGGCTTCAAAGGGAAGCAGG + Intronic
1196598782 X:117576831-117576853 CAGAGGCTGGAAAGGGAAGTGGG - Intergenic
1196898422 X:120360280-120360302 CAGTGGCTACAAAGGGACAAGGG - Intergenic
1197250956 X:124216092-124216114 CAGTGAGTACAAAGGAAAAAGGG - Intronic
1197309834 X:124891138-124891160 CAGGGGCTGAAAAGGGTAGAGGG + Intronic
1197876058 X:131108382-131108404 CAGAGGCTGTAAAGGGAAGTGGG - Intergenic
1198003770 X:132469874-132469896 TAGTGGCTGCTTAGGGAAGAAGG - Intronic
1198148386 X:133882222-133882244 CACTGGTTACAAAAGGAAGCAGG - Intronic
1198341873 X:135722306-135722328 CAGAGGCTACAAAGGTTAGTGGG - Intronic
1198346121 X:135761057-135761079 CAGAGGCTACAAAGGTTAGTGGG + Intronic
1198348026 X:135778341-135778363 CAGAGGCTACAAAGGTTAGTGGG + Intergenic
1198349932 X:135795603-135795625 CAGAGGCTACAAAGGTTAGTGGG + Intronic
1198351840 X:135812875-135812897 CAGAGGCTACAAAGGTTAGTGGG + Intronic
1198353746 X:135830145-135830167 CAGAGGCTACAAAGGTTAGTGGG + Intronic
1198355656 X:135847393-135847415 CAGAGGCTACAAAGGTTAGTGGG + Intronic
1198357567 X:135864672-135864694 CAGAGGCTACAAAGGTTAGTGGG + Intergenic
1198359478 X:135881959-135881981 CAGAGGCTACAAAGGTTAGTGGG + Intronic
1198499235 X:137226205-137226227 AAGTGGCCAGGAAGGGAAGAAGG - Intergenic
1199442685 X:147886325-147886347 CAGAGGCTGCAAAGGGTAGTGGG - Intergenic
1199926350 X:152469287-152469309 CAGAGGCTACAGAGTGAAGGGGG + Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic