ID: 1042338720

View in Genome Browser
Species Human (GRCh38)
Location 8:67656522-67656544
Sequence GCTCACAACCCAGCATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042338720_1042338723 3 Left 1042338720 8:67656522-67656544 CCATGTGATGCTGGGTTGTGAGC 0: 1
1: 0
2: 1
3: 13
4: 152
Right 1042338723 8:67656548-67656570 ACCTTATGACCATGTTGAGGTGG No data
1042338720_1042338722 0 Left 1042338720 8:67656522-67656544 CCATGTGATGCTGGGTTGTGAGC 0: 1
1: 0
2: 1
3: 13
4: 152
Right 1042338722 8:67656545-67656567 CTGACCTTATGACCATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042338720 Original CRISPR GCTCACAACCCAGCATCACA TGG (reversed) Intronic
900115964 1:1028011-1028033 GCTCACACCCCAGCCTCCCCTGG - Intronic
900187397 1:1338808-1338830 GCTCACGCCCCAGCCTCACGGGG - Intronic
900922932 1:5685138-5685160 GCTCCCTACCCAGCCCCACAAGG - Intergenic
904481817 1:30798678-30798700 CCTCACAACCCACCAGCACCTGG + Intergenic
908757358 1:67481118-67481140 GCTTGGAACCCAGCAACACATGG - Intergenic
911020946 1:93387083-93387105 CCTGACTACCCAGCATGACATGG - Intergenic
913133657 1:115865705-115865727 GTCCACCACCCAGCATCACCTGG - Intergenic
915593769 1:156884888-156884910 CCTCACTCCCCAGCATCCCAGGG - Intergenic
917792758 1:178509875-178509897 TCCCACAACCAACCATCACAGGG - Intergenic
922042181 1:221907242-221907264 GTTCTCAGCCCAGCATCACCGGG + Intergenic
1063593312 10:7411782-7411804 GCTCACACCCCAGCAAAACGTGG + Intergenic
1064887763 10:20130828-20130850 GATCACTACCCATGATCACATGG - Intronic
1065776149 10:29121981-29122003 GTCCAGAACCCAGCATCAGAGGG - Intergenic
1069669597 10:70190498-70190520 GCTATTAAACCAGCATCACATGG + Intergenic
1070301893 10:75210177-75210199 GCACACAACCCAGCACAGCAAGG + Intronic
1070626131 10:78052695-78052717 GCTTACACCCCATCATCTCAAGG - Intronic
1072263401 10:93703922-93703944 GCTAATAACACAGCAGCACAGGG - Intergenic
1076493417 10:130879684-130879706 GGTCTCAACTCAGCATCCCATGG - Intergenic
1076984022 11:222626-222648 GCTCACAGCCCAGCACCCAACGG + Intronic
1077323148 11:1951363-1951385 GCTCCCAACCCAGCCTCTCAGGG - Intronic
1078414054 11:11150680-11150702 GCTTGCAACCCTGTATCACAGGG + Intergenic
1078443196 11:11384668-11384690 GCTCACATCTCATCCTCACATGG - Intronic
1079863133 11:25699609-25699631 GATAACAACCTAGCATGACATGG - Intergenic
1080617008 11:33953332-33953354 GCTCACATCCCAGCTTCTTAGGG - Intergenic
1081864858 11:46353892-46353914 GCCCACACCCCAGCATCTCGCGG + Intronic
1085706505 11:78791023-78791045 GCTCACAACCCAGCTTGTAAAGG - Intronic
1090738545 11:129634415-129634437 GCCCTCAACACAGCATCACTGGG + Intergenic
1090873746 11:130770575-130770597 GCTCTCAAGACAGCATTACAGGG + Intergenic
1202806134 11_KI270721v1_random:6558-6580 GCTCCCAACCCAGCCTCTCAGGG - Intergenic
1094720971 12:33063527-33063549 TCTCAGATCCCAGCAGCACAAGG - Intergenic
1097245673 12:57606364-57606386 GCCCCCAACCCAGCAGCCCATGG - Intronic
1102838010 12:116085195-116085217 ATTCACAATCCAGCATGACAGGG + Intronic
1105454652 13:20528897-20528919 GATCAAAAGCCAGCCTCACAAGG + Intergenic
1106921042 13:34563378-34563400 CCTCACAGCTCAGCCTCACAGGG - Intergenic
1110986288 13:81973902-81973924 GCTCACAAACCCACATCACCAGG + Intergenic
1112169600 13:96957039-96957061 GCTTACAACCAAGCACTACAAGG + Intergenic
1115086979 14:29529156-29529178 ACTTACAAACCAGCATAACAGGG + Intergenic
1121414711 14:93771413-93771435 GTTCACAAGGCGGCATCACATGG + Intronic
1122441698 14:101736583-101736605 GCTCAGGACCAAGCATCTCATGG - Intergenic
1122665956 14:103329747-103329769 GCTCACAGCTCAGAAACACAAGG + Intergenic
1123008738 14:105337024-105337046 CCGCACCACCCAGCATCACTGGG + Intronic
1125378394 15:39059159-39059181 GGGCACAACCAAGCACCACAGGG - Intergenic
1125743008 15:41980504-41980526 GCTCCCAACCCAGCCACAGAGGG - Intergenic
1127880348 15:63151821-63151843 GCTCCAAACCCAGCTTCACAAGG - Exonic
1129691361 15:77715479-77715501 GCCCAAGTCCCAGCATCACAGGG - Intronic
1130220846 15:82018280-82018302 GCTCACAGCCCAGGATCTCTGGG + Intergenic
1130950898 15:88586791-88586813 GCTCACAGGCGAGCCTCACAGGG + Intergenic
1131549642 15:93346201-93346223 GCTCTAAAGCCAGCAACACAGGG + Intergenic
1132812110 16:1805182-1805204 TCTCACAACCCAGGAACAGAAGG - Intronic
1133177543 16:4026645-4026667 GGGCACTACTCAGCATCACAAGG + Intronic
1133373503 16:5264273-5264295 CCTCACATCCCAACATCAAACGG - Intergenic
1134896868 16:17896121-17896143 GATCACACCCCAGCATTCCAAGG + Intergenic
1138287465 16:55821222-55821244 ACTCACAGCCCAGCATCAGGGGG - Intronic
1139303418 16:65963878-65963900 TCACACAACCCAGCAGCCCAGGG - Intergenic
1139878211 16:70163443-70163465 GCTCATTACCCAGCCTCACAGGG + Intergenic
1140359352 16:74331369-74331391 GCTCATTACCCAGCCTCACAGGG - Intergenic
1140364887 16:74373677-74373699 GCTCATCACCCAGCCTCAAAGGG + Intergenic
1140647177 16:77045328-77045350 GCGCACTTCACAGCATCACAGGG + Intergenic
1144992948 17:19246462-19246484 GCTCACACCCCAGCCTCCCCAGG - Intronic
1148197450 17:45724626-45724648 GCTCACAACCTACAATTACAAGG - Intergenic
1148902448 17:50888457-50888479 CCTCACAACCAAGCCCCACAAGG + Intergenic
1152490993 17:80633577-80633599 GATCACAGCCCCGCATCACCTGG - Intronic
1152515181 17:80819160-80819182 GCTCCCTCCCCAGCATCACCAGG + Intronic
1158714634 18:59867174-59867196 GTTCTCATCCAAGCATCACATGG + Intergenic
1159411977 18:68089617-68089639 TCTTACAACCCATCATCATATGG + Intergenic
1160835190 19:1121663-1121685 GTTCACTCCCCAGCATCCCAGGG - Intronic
1161056477 19:2193134-2193156 GCACACAACCCAGCAACACCCGG - Intronic
1161374919 19:3934467-3934489 GCTCACACCCCCGCCTCAGAAGG + Intronic
1161396024 19:4045386-4045408 GTTCACACCCCAGTGTCACAGGG - Exonic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925269313 2:2591107-2591129 GCTCAGACCCCACCAGCACATGG + Intergenic
926209878 2:10861997-10862019 GCTCACAGCCCAACAGGACAGGG - Intergenic
927193589 2:20533180-20533202 GCCCACATCCCAGCAGGACAGGG - Intergenic
930728328 2:54704288-54704310 GCTCTCATCACAGGATCACAGGG - Intergenic
938285078 2:130106063-130106085 TCTCACAACACAACATCGCAAGG - Intronic
938334573 2:130480062-130480084 TCTCACAACACAACATCGCAAGG - Intronic
938335722 2:130494612-130494634 TCTCACAACACAACATCGCAAGG - Intronic
938354099 2:130626052-130626074 TCTCACAACACAACATCGCAAGG + Intronic
938355252 2:130640608-130640630 TCTCACAACACAACATCGCAAGG + Intronic
938430527 2:131232829-131232851 TCTCACAACACAACATCGCAAGG + Intronic
938475352 2:131605999-131606021 TCTCACAACACAACATCACAAGG + Intergenic
938547578 2:132348483-132348505 GCACCCAACCCAGCCTCAAAGGG - Intergenic
941796196 2:169601578-169601600 GCTCTCAAACCATCTTCACATGG - Intronic
946306966 2:218861539-218861561 CCTCACAACCCAGCTTCTCCTGG + Intronic
946914055 2:224497797-224497819 GCTCACACTCCAGCATCATATGG - Exonic
948638432 2:239356840-239356862 CCTCAGATCCCAACATCACAAGG + Intronic
948638603 2:239358671-239358693 CCTCAGATCCCAACATCACAAGG + Intronic
948661345 2:239508383-239508405 GCTCACACCCCAGCTTCATGCGG + Intergenic
1168935290 20:1659859-1659881 CCTGACAACCCATGATCACATGG + Intergenic
1168938485 20:1688533-1688555 CCTGACAACCCAAGATCACATGG + Intergenic
1169071215 20:2731822-2731844 GTTCACATCCCAGAAGCACAAGG - Intronic
1170296362 20:14831026-14831048 GCTCACAAACCACCATCCCGAGG - Intronic
1171876445 20:30581239-30581261 GCACCCAACCCAGCCTCAAAGGG - Intergenic
1173172938 20:40742052-40742074 GCCCACCACCCACCACCACAAGG - Intergenic
1173302448 20:41816256-41816278 GCACACAACCCAGCACTTCAAGG - Intergenic
1173688076 20:44938000-44938022 GCTCACACCCCAGCATCCCAGGG - Intronic
1175402700 20:58709605-58709627 ACTCACAACCCAGCCTAACCAGG + Intronic
1175838692 20:62013213-62013235 GGTCACAAGCCAGCAGCACGAGG - Intronic
1178143557 21:29712972-29712994 GCTGTCAACATAGCATCACAAGG - Intronic
1179490478 21:41737983-41738005 GGTTACAGCCCAGCATCCCAGGG - Intergenic
1179491133 21:41742246-41742268 GCTCACCACCCCGCAGGACAGGG - Intronic
1180854833 22:19039224-19039246 GCTCACCACCCAGCTTCAGGGGG - Intronic
1181463676 22:23099467-23099489 GAACACAGCCCAGCAACACAAGG + Intronic
1181479089 22:23186242-23186264 GCACACAGCCTAGAATCACAAGG - Intronic
1182539723 22:31032258-31032280 GCTCTCCACCCAGTAGCACAGGG - Intergenic
1183439704 22:37816260-37816282 GGGCATCACCCAGCATCACAGGG - Exonic
1183921668 22:41174318-41174340 CCTCCCACCCCAGCATCCCAAGG - Intronic
1184244579 22:43229379-43229401 GCTCCCAACCCAGAAACAGAAGG - Intronic
1185411925 22:50687211-50687233 GCTCATAACCAAGCCTTACAGGG - Intergenic
950938979 3:16874183-16874205 GCTCCCAAGCCAGCCACACAAGG + Intronic
953338678 3:42115820-42115842 GCTCACACCCCAGCCACAAAGGG - Intronic
954717705 3:52534459-52534481 GCCCACAACCCTGCAGCGCACGG - Intronic
955753939 3:62209019-62209041 GCGCCAAAGCCAGCATCACATGG - Intronic
965076398 3:163983116-163983138 GTTCACAACACCGCATGACATGG + Intergenic
967892021 3:194370365-194370387 GCAAAGACCCCAGCATCACAAGG - Intergenic
968754308 4:2407416-2407438 GCTCAGAACGCAGCATCTGAGGG - Intronic
969593989 4:8137672-8137694 GCTCACAGGCCAGCCTGACAGGG + Intronic
971543403 4:27851711-27851733 GGTCACAGCTCAGCATCAGAGGG + Intergenic
971627540 4:28941793-28941815 GCTCACAATTCAGCATCTCTGGG + Intergenic
976086592 4:81413142-81413164 GATCACAAAGCAGGATCACAGGG + Intergenic
976904399 4:90218395-90218417 CCCCAAAACCCAGCATCACACGG + Intronic
978898468 4:113919795-113919817 GCTCATGACTCAGCATGACAAGG + Intronic
982243642 4:153326442-153326464 GCTAACTGCCCAGCATTACATGG - Intronic
989101384 5:37826476-37826498 GCCCACAACCCACCATGCCAGGG - Intronic
997986548 5:138505765-138505787 TCCCATAACCCAGCATCCCATGG - Intergenic
999204779 5:149840193-149840215 GCTCACCAGCCAGCCTCAAAAGG - Intronic
999829353 5:155304104-155304126 CCTCCAAAACCAGCATCACACGG - Intergenic
1003482938 6:6549609-6549631 GCTGAGAACCCTGAATCACAAGG - Intergenic
1006080656 6:31564126-31564148 CCTCAAACCCCAGCATCACTTGG - Intergenic
1006379691 6:33690300-33690322 GCTCCCAGCCCAGCAGCAAAAGG - Intronic
1006604524 6:35246472-35246494 GCTCAAATCCCAGCTTCCCATGG - Intronic
1007158066 6:39765317-39765339 GGACAAAACCAAGCATCACATGG - Intergenic
1013368433 6:109451560-109451582 GCTCACCACCCAGCCTCTCCTGG + Intronic
1013724911 6:113082249-113082271 GGTCACATAGCAGCATCACAGGG + Intergenic
1016417746 6:143850931-143850953 GCACCAAACCCAGCATCACAGGG + Intronic
1018797363 6:167196686-167196708 CCTCAACACGCAGCATCACATGG + Intronic
1018818934 6:167358078-167358100 CCTCAACACGCAGCATCACATGG - Intronic
1019089263 6:169513142-169513164 GCCCCCAACCAAGCACCACAGGG - Intronic
1020686847 7:11307034-11307056 CATCACACACCAGCATCACAAGG + Intergenic
1026921631 7:74159939-74159961 ACTCCCAACCTTGCATCACATGG + Intergenic
1034055334 7:148028717-148028739 CTTCACAACCCAGGTTCACATGG + Intronic
1034310316 7:150082098-150082120 GCTCACAACCCAGCTTGTCTGGG - Intergenic
1034328798 7:150264152-150264174 GGTCACAACCCAGCAACAGGCGG + Intronic
1034669250 7:152845599-152845621 GGTCACAACCCAGCAACAGGCGG - Intronic
1034796529 7:154018555-154018577 GCTCACAACCCAGCTTGTCTGGG + Intronic
1035678124 8:1469123-1469145 GCTCACATCCCAGCTGGACACGG - Intergenic
1037474643 8:19245095-19245117 GCTAACATCCCAGCTCCACAGGG - Intergenic
1038238729 8:25787991-25788013 GCTCCCAACCCACCAGCTCAAGG + Intergenic
1039938226 8:42066665-42066687 GCTAACAATCCATCCTCACACGG - Intergenic
1040082849 8:43306676-43306698 TCTCACAACACAACATCACAAGG + Intergenic
1041994298 8:64034975-64034997 GGTTACAACCCATCATCACCAGG + Intergenic
1042338720 8:67656522-67656544 GCTCACAACCCAGCATCACATGG - Intronic
1047457763 8:125031668-125031690 GCACAGGACCCAGCATCTCATGG + Intronic
1049162470 8:141106123-141106145 GCTCCCAGCCCAGCTTCCCAGGG + Intergenic
1051355472 9:16236073-16236095 GCTCACCACTCTGCATCCCAGGG + Intronic
1055572463 9:77631304-77631326 GTTTACATCCCATCATCACATGG + Intronic
1055870333 9:80869876-80869898 GCTCAAAATTCAGCATCACAGGG + Intergenic
1058568244 9:106310406-106310428 CCTCACAACTCAGGATAACAGGG - Intergenic
1062199993 9:135297514-135297536 GGTCTCGACCCAGCATCTCACGG - Intergenic
1062342057 9:136098134-136098156 TGTCACAACACAGCAGCACAGGG + Intergenic
1185782003 X:2855814-2855836 GCTCCCAACTCAGCCTCCCAGGG - Intronic
1186758081 X:12694121-12694143 GCACACAACCCCTCATCTCAGGG + Intronic
1186865457 X:13716469-13716491 GCTCACAAACCAGAAGAACATGG - Intronic
1192153079 X:68724044-68724066 GCTCACATCCCAGTACCTCATGG + Exonic
1199110910 X:143933009-143933031 CCCCAAAACTCAGCATCACAAGG - Intergenic
1199908035 X:152255355-152255377 TCTCACAACTCTGCATCATAGGG + Intronic
1200087992 X:153619527-153619549 ACTCACAAACCAGCAGCACATGG - Intergenic