ID: 1042340280

View in Genome Browser
Species Human (GRCh38)
Location 8:67671570-67671592
Sequence CTTTAGTCAAGTAGCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042340280 Original CRISPR CTTTAGTCAAGTAGCAGAGC TGG (reversed) Intronic
902613970 1:17613751-17613773 CTTTAGCCAAGACACAGAGCAGG - Intronic
903117274 1:21188630-21188652 CTTTATTCAAGTAGAAGAAAAGG - Intergenic
909490286 1:76218791-76218813 TTTTTGTGAAGTGGCAGAGCTGG - Intronic
911328690 1:96499796-96499818 CTTTAGTAAAGAAGCATTGCTGG - Intergenic
913714760 1:121522261-121522283 ACTTAGTTAAGCAGCAGAGCGGG + Intergenic
915797284 1:158750445-158750467 CTGTAGTCAGGTAGCTAAGCAGG - Intergenic
916417743 1:164608737-164608759 GTTTGGGCAACTAGCAGAGCTGG + Intronic
923546064 1:234924041-234924063 TTATAGTCCAGTAGCTGAGCTGG - Intergenic
1065513249 10:26500445-26500467 TTTTAGAAAAGTAGCAGAGGGGG - Intronic
1068688341 10:59891645-59891667 GTTCAGACAAGTAGCAGAGAGGG + Intronic
1071476927 10:86033191-86033213 CCTGAGTCAAGCAGAAGAGCTGG + Intronic
1073470133 10:103717126-103717148 CCTGAGGCAAGTGGCAGAGCTGG + Intronic
1074350186 10:112729073-112729095 TTTTAGTCAAGGAGCAAAGAAGG - Intronic
1074459966 10:113627755-113627777 CTTTAAGTAAGTAGAAGAGCTGG - Intronic
1075187843 10:120278829-120278851 CTGGAGTAAAGTGGCAGAGCAGG + Intergenic
1075410272 10:122222595-122222617 CTTTTGGCAGGTAGCAGAGAAGG + Intronic
1076571421 10:131435787-131435809 CTTTAGTCAGAGGGCAGAGCAGG + Intergenic
1077324390 11:1957445-1957467 CTTTAGACAAGAATCAGAGCAGG - Intronic
1078354461 11:10623784-10623806 CCTTAGTGAAGCAGCTGAGCAGG - Exonic
1079881768 11:25936982-25937004 ATTTATTCAAGTATTAGAGCTGG - Intergenic
1080421254 11:32112544-32112566 ATTTGGTTAAGTGGCAGAGCTGG - Intergenic
1081040288 11:38201440-38201462 CTTTGGCCAAGTTACAGAGCAGG - Intergenic
1081663286 11:44901589-44901611 CTTGTGTCAAATGGCAGAGCAGG - Intronic
1081671548 11:44945390-44945412 CTTGAGGTAAGTGGCAGAGCTGG + Intronic
1085419746 11:76345798-76345820 CTTTCATCCAGTGGCAGAGCCGG + Intergenic
1085702094 11:78754753-78754775 GGCTAGTCAAGTGGCAGAGCCGG - Intronic
1089553746 11:119302761-119302783 CTTTAGTTAAGTAATAGACCAGG + Exonic
1089684613 11:120138795-120138817 CCTAAGTCAAGTGGCCGAGCTGG + Intronic
1090274586 11:125410435-125410457 CTTTAGTCAAGAAACTGAGCTGG - Intronic
1202807371 11_KI270721v1_random:12622-12644 CTTTAGACAAGAATCAGAGCAGG - Intergenic
1091451557 12:575429-575451 CTGTAGTCCTGGAGCAGAGCAGG - Intronic
1092617468 12:10228630-10228652 CTCTAGTCAAGCAGCAGAGCTGG - Intergenic
1093590625 12:20897737-20897759 CATTAGTAAAGGAGGAGAGCTGG - Intronic
1100330754 12:93579766-93579788 CTGAAGTCATGGAGCAGAGCTGG + Intronic
1104022975 12:125006061-125006083 CCTTATGCAAGTAGGAGAGCAGG - Intronic
1105952837 13:25246733-25246755 ATTTGGTCGGGTAGCAGAGCAGG - Exonic
1107128300 13:36868437-36868459 ATTTACTCAAGAAGCAGAACAGG + Intronic
1107344710 13:39446700-39446722 CTCTAGTTAAGTGGCAAAGCCGG + Intronic
1108005270 13:45939902-45939924 ATTTAACCAAGGAGCAGAGCGGG - Intergenic
1109109933 13:58303940-58303962 TCTTAGTCAAGAAGCAGAGTTGG + Intergenic
1109848717 13:68032799-68032821 CTTTAGTCAAGAAGGAAATCTGG + Intergenic
1110707862 13:78615451-78615473 CTTTAGTCAAGTATCAAGTCAGG - Exonic
1111404360 13:87783075-87783097 CTAAAGTCAAGTAGTGGAGCTGG - Intergenic
1114296802 14:21337197-21337219 ATCTAGTTAAGTAGCAGAGCTGG - Intronic
1115302633 14:31901613-31901635 CAATTGTCAAGTAGGAGAGCTGG + Intergenic
1118116669 14:62785432-62785454 CTGTAGTCAAGTAGATGAACCGG - Intronic
1133066024 16:3207650-3207672 CTTTGGTCTAGCAGCAGTGCTGG - Intergenic
1134872228 16:17662345-17662367 ATTTGCCCAAGTAGCAGAGCTGG + Intergenic
1135631078 16:24035912-24035934 CTTTACTCAGATAGCAGAGAAGG + Intronic
1138268543 16:55678170-55678192 TTTTAGGTAAGTGGCAGAGCTGG + Intronic
1140696785 16:77542706-77542728 CTTTAATGTAGTGGCAGAGCTGG + Intergenic
1141366639 16:83449712-83449734 CATTAGGCAAGTTGCAGAACAGG - Intronic
1145900102 17:28485089-28485111 CTACAGTCAAGGAACAGAGCTGG + Intronic
1146642367 17:34550895-34550917 CTTTAGTGCAGTAACAGAGATGG - Intergenic
1146919294 17:36699298-36699320 CTTTAGTAGAGTGTCAGAGCTGG + Intergenic
1149254720 17:54812930-54812952 CTTTAGTCCAACAGAAGAGCTGG - Intergenic
1150802975 17:68296320-68296342 CTTTAGGCAAGAAACACAGCAGG - Intronic
1154344917 18:13533870-13533892 CTTTTGTCAAGTAGGAGAGCTGG - Intronic
1155902621 18:31410051-31410073 CCTTAAGCAAGTGGCAGAGCTGG - Intronic
1157296822 18:46451008-46451030 CATTAGTAAAGAAGGAGAGCTGG + Intronic
1164419029 19:28071426-28071448 TTATAGCCAAGAAGCAGAGCTGG - Intergenic
1164498384 19:28791532-28791554 CTTCTGTCAAGTAGCTGAGGTGG + Intergenic
1167030019 19:46952552-46952574 GTTTAGCCAAGTGGCAGAGCTGG - Intronic
1167513315 19:49908551-49908573 AGTTGGTCAAGGAGCAGAGCGGG - Exonic
928043059 2:27897679-27897701 ATTTAGTCAAGCAGCAGGCCTGG + Intronic
929865235 2:45712034-45712056 CTTTACTCAAGTAACAGTGGGGG - Intronic
930609609 2:53526915-53526937 CTTTAGTCCTCTACCAGAGCTGG - Intergenic
938906863 2:135845476-135845498 CTTTAGACCAGTAGGAGAGAAGG - Intronic
941279926 2:163537177-163537199 CTATAAACAAGAAGCAGAGCTGG - Intergenic
942917668 2:181331194-181331216 CATTAGTCAAGTTGCTGAGAAGG - Intergenic
943960635 2:194258010-194258032 CGTTAGTGAAGTAGAAGAGATGG + Intergenic
944884117 2:204045246-204045268 CTTTAGTGGAGTAGCAGGGGTGG + Intergenic
946575119 2:221066855-221066877 CACAAGTCAAGTGGCAGAGCTGG - Intergenic
947001212 2:225458804-225458826 CTTTAGTCAAGAAGCTGTGTTGG + Intronic
1168912770 20:1463067-1463089 TTTTACTTAAGTGGCAGAGCTGG + Intronic
1170501421 20:16978435-16978457 CTAGAGTCAAGGGGCAGAGCAGG - Intergenic
1173128254 20:40360611-40360633 CCTTTGCCAAGAAGCAGAGCTGG + Intergenic
1173215505 20:41078501-41078523 CTTTAGACAAGGAGAAAAGCAGG + Intronic
1174741038 20:53014588-53014610 CTTTAGTCAAGAGGAAGAGGAGG - Intronic
1179510515 21:41870015-41870037 CTTTAATCAAGTCTCAGAGCTGG + Intronic
1182091867 22:27601438-27601460 GCTTAGTCACATAGCAGAGCTGG - Intergenic
1184841442 22:47054689-47054711 TTGAAGTCAAGTAGCAGGGCCGG + Intronic
951851161 3:27141325-27141347 CTTTAGTTTAGCAGCAGAGCTGG - Intronic
954952744 3:54489611-54489633 CTGTAGATAAGGAGCAGAGCTGG + Intronic
955212221 3:56953004-56953026 CTTTAGGCAAATAGCAGGGGTGG + Intronic
955580756 3:60418576-60418598 TTTTAGTAGAGGAGCAGAGCTGG + Intronic
961058939 3:123812211-123812233 CTTGAGCCCAGAAGCAGAGCGGG - Intronic
961591710 3:127986184-127986206 GGTTAGCTAAGTAGCAGAGCGGG - Exonic
962035635 3:131648668-131648690 TTATAATCAAGAAGCAGAGCTGG - Intronic
962929585 3:140024048-140024070 CATTATGCAATTAGCAGAGCCGG - Intronic
963179378 3:142338213-142338235 CTTTCGTCAAGTGGAAGAGAGGG - Intronic
963274735 3:143318719-143318741 CTTCAGGCAGGTAGCAGAACTGG - Intronic
965692980 3:171377381-171377403 CTTGAGTGAAGCAGCTGAGCGGG - Intronic
966507303 3:180720555-180720577 AATTAGTCAAATGGCAGAGCTGG - Intronic
968843091 4:3022637-3022659 GTTTAGGCAAGAAGCAGAGATGG + Intronic
968962121 4:3750954-3750976 ATTTATTCAATTAGCAGGGCCGG - Intergenic
971169836 4:24222114-24222136 CTTGAGTCAAAAAGCAGAGGAGG + Intergenic
976422802 4:84865627-84865649 TTATAGCCAAGTAGCAGGGCTGG - Intronic
978294637 4:107190759-107190781 CTATAGTCAACTAGCAGGCCAGG + Intronic
978561497 4:110038654-110038676 CTTTATTCTAGTTTCAGAGCTGG + Intergenic
986681819 5:10240497-10240519 CATTAGTGAGGTGGCAGAGCTGG - Intronic
986957842 5:13176603-13176625 CTTTATTCAATTATCAGAGTGGG + Intergenic
987658077 5:20833977-20833999 CATTAGTAAAGTTGCAAAGCAGG - Intergenic
989440819 5:41471046-41471068 TTATAGTCAAGGAGCAGGGCAGG + Intronic
989962976 5:50438187-50438209 ACTTAGTTAAGCAGCAGAGCAGG - Intronic
989963594 5:50443396-50443418 ACTTAGTTAAGCAGCAGAGCAGG + Intergenic
991649787 5:68840075-68840097 CTTGTGGCAAGTTGCAGAGCAGG - Intergenic
993173194 5:84447484-84447506 TTTTAGTCAACTACAAGAGCTGG - Intergenic
1001679140 5:173543604-173543626 CTGCAGCCAAGTGGCAGAGCTGG + Intergenic
1002469158 5:179424596-179424618 CTCCAGTGAAGTGGCAGAGCTGG + Intergenic
1004335120 6:14757423-14757445 CCCTAGTCAAGAAGCACAGCAGG + Intergenic
1006957740 6:37890890-37890912 CTCTAGCCAAATGGCAGAGCAGG + Intronic
1007129010 6:39452133-39452155 CTTTAATCCAGAAGCAGAACTGG + Intronic
1012765381 6:103361015-103361037 CCTTAGCAAAGTAGCAAAGCTGG + Intergenic
1016308379 6:142707493-142707515 CATAAGACAAGAAGCAGAGCAGG + Intergenic
1017936219 6:159007606-159007628 CTTCAGTTAAGTAGCAGAAAAGG + Intergenic
1018186672 6:161271158-161271180 CTTTAGTATAGAAGTAGAGCAGG - Intronic
1018292086 6:162302160-162302182 CTTTACTCAAGTGGTAGAGGGGG - Intronic
1018982593 6:168612237-168612259 CTTTACTCAAACAGCAGCGCTGG + Intronic
1018982605 6:168612297-168612319 CTTTACTCAAACAGCAGCGCTGG + Intronic
1018982640 6:168612476-168612498 CTTTACTCAAACAGCAGTGCTGG + Intronic
1018982652 6:168612535-168612557 CTTTACTCAAACAGCAGCGCTGG + Intronic
1020957699 7:14762294-14762316 AATTACTCAAGTACCAGAGCAGG - Intronic
1021629872 7:22634191-22634213 CCTTAGTCAAGAGGCAGAGTAGG - Intergenic
1023216179 7:37865596-37865618 CTATAGTCGAATAGCAGACCAGG + Exonic
1024001208 7:45190491-45190513 CCTTAGTCAAGGAGCTGACCAGG + Intergenic
1026189945 7:68116560-68116582 CTTCAGTGAACTAACAGAGCAGG - Intergenic
1034717559 7:153257289-153257311 GTTTTGACAAGCAGCAGAGCAGG + Intergenic
1039290306 8:36087679-36087701 TTTTAGTCAATTAGGAGAGAGGG - Intergenic
1042340280 8:67671570-67671592 CTTTAGTCAAGTAGCAGAGCTGG - Intronic
1043558019 8:81456931-81456953 CTTTAGTGACGTCTCAGAGCAGG - Intergenic
1045755824 8:105540296-105540318 CCTTGCTCAAGTAGCAGAGTCGG - Intronic
1050371171 9:4922820-4922842 CCTTTCCCAAGTAGCAGAGCTGG - Intergenic
1061885655 9:133590015-133590037 CTTAAGTCCAGCAGCAGAGAGGG - Intergenic
1185711397 X:2306406-2306428 CTTTGGACAAAGAGCAGAGCAGG + Intronic
1192197754 X:69041124-69041146 ATTCAGTCAAGTTGCAGAACAGG + Intergenic
1193557483 X:82973947-82973969 CTTGACTCAACTAGCAGAGCAGG + Intergenic
1198737670 X:139805334-139805356 ATATAGTTAAGTGGCAGAGCTGG - Intronic