ID: 1042341377

View in Genome Browser
Species Human (GRCh38)
Location 8:67683667-67683689
Sequence TTGAATAGGCATAAAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042341377 Original CRISPR TTGAATAGGCATAAAGAAGA GGG (reversed) Intronic
901074788 1:6547134-6547156 TTGAATAGATAGAAACAAGATGG - Intronic
902135773 1:14303693-14303715 TTGGATAGGCATAAATGGGAAGG - Intergenic
902533344 1:17104727-17104749 TTGAAAAGGCAAAAAGAGGCCGG - Intronic
902554497 1:17238973-17238995 GTGAACAGGGATAAGGAAGAGGG - Intronic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
905705003 1:40049094-40049116 TTGAATAGGCAGAAGGAATTGGG + Intronic
905827294 1:41035485-41035507 TGGACTAGTCTTAAAGAAGATGG - Intronic
907202354 1:52738559-52738581 TTGAATAGGCATTAAGACACTGG - Intronic
908002567 1:59694898-59694920 TTGGATAGGCATAGAGAGTATGG + Intronic
908514366 1:64877006-64877028 TTGAAAAGGAATACAGAATATGG + Intronic
908949383 1:69541214-69541236 ATGAAAAGGCAGAAAGATGAGGG - Intergenic
908971615 1:69841585-69841607 ATGAAATGGTATAAAGAAGAAGG - Intronic
909214703 1:72871615-72871637 CAGAATAGGCAGAGAGAAGATGG - Intergenic
911042460 1:93601743-93601765 TTGAATAAAGAAAAAGAAGAAGG + Intronic
911468670 1:98287752-98287774 TTTAATAGGAATAAAGAAGTAGG + Intergenic
911503502 1:98718741-98718763 TTGCATATGCATAAAGAAAGTGG - Intronic
913713593 1:121511646-121511668 TTGCATAGGCATAATGGACATGG - Intergenic
915822128 1:159035332-159035354 CTGAAAAGGCACAAAGAAAATGG - Intronic
918274117 1:182935138-182935160 TAGAATAGCCAAAAAGTAGAAGG - Intronic
921797272 1:219360887-219360909 TTGATGAGGCAGAAAGAACATGG - Intergenic
922293071 1:224225196-224225218 GTGAAAGGGCATGAAGAAGAGGG - Intergenic
923031232 1:230250434-230250456 CTAAAGAGGCAGAAAGAAGAGGG - Intronic
923350035 1:233095541-233095563 CTGAATATGCATTAAGAAGCAGG + Intronic
923871942 1:238004575-238004597 TTATAAAGGCATAAAGTAGAGGG - Intergenic
924852704 1:247846564-247846586 TAGATCAGGCCTAAAGAAGAAGG - Intergenic
1063638038 10:7803901-7803923 TTAAGTGGGCATAAAGAAGGGGG - Intronic
1065395533 10:25232805-25232827 ATGAATAAGCTAAAAGAAGAGGG - Intronic
1066633936 10:37482588-37482610 TTGAAAAGGAAAAAAAAAGAAGG - Intergenic
1067740700 10:48894158-48894180 CTGAATAGCCATATAGAGGATGG - Intronic
1067983168 10:51110952-51110974 TTGAAAAAGCATAAAGAAAGGGG + Intronic
1068157277 10:53216967-53216989 TTGAAAAGGGACAAAGAGGAAGG - Intergenic
1068228982 10:54145122-54145144 TAAAATATGAATAAAGAAGAGGG + Intronic
1068941337 10:62684142-62684164 TTTCATAGGCATATAGATGACGG - Intergenic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1070226741 10:74515926-74515948 TGGAGTTGGCATAATGAAGATGG + Intronic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1072064563 10:91853412-91853434 TTGAATGAACATAAAGAAGATGG - Intronic
1072984455 10:100127828-100127850 GGGAATTGGCATAAAGGAGATGG + Intergenic
1073843420 10:107524904-107524926 TTGAATGGGCATAAGGGAAAAGG + Intergenic
1074006560 10:109431120-109431142 TTGAATAAGCAGGAAGAACAGGG - Intergenic
1075489328 10:122853089-122853111 TTGAATAGGTGGAGAGAAGAAGG - Intronic
1077905416 11:6529153-6529175 GTGAATAGACATACAGAAAAGGG - Intronic
1078170129 11:8923492-8923514 TAGAGAGGGCATAAAGAAGATGG - Intronic
1079078639 11:17398598-17398620 TTGAATAAGCAGAAAGGAGTGGG - Intronic
1080580152 11:33635650-33635672 TAGAATGGGCTTAACGAAGAGGG - Intronic
1080785908 11:35474852-35474874 ATGAATAGGGAAAAGGAAGAAGG + Intronic
1081061523 11:38483939-38483961 TTGAAAAGGCATAAAGAAACAGG + Intergenic
1081078792 11:38712686-38712708 TATAATAAGCATACAGAAGAGGG + Intergenic
1082163334 11:48908852-48908874 TTGATAAGGCATAAGGAAGAGGG - Intergenic
1082169479 11:48985788-48985810 TTGATAAGGCACAAGGAAGAGGG + Intergenic
1082234736 11:49810299-49810321 TTGATAAGGCACAAGGAAGAGGG - Intergenic
1082238068 11:49843879-49843901 TTGATAAGGCACAAGGAAGAGGG + Intergenic
1082608437 11:55270994-55271016 TTGATAAGGCACAAGGAAGAGGG - Exonic
1082658561 11:55881304-55881326 TTGATAAGGCACAAGGAAGAGGG - Intergenic
1082682198 11:56188505-56188527 GTGAACATACATAAAGAAGAAGG + Intergenic
1086119332 11:83289289-83289311 TACAATAGGCACAAAGAAAATGG - Intergenic
1086696355 11:89850850-89850872 TTGATAAGGCACAAGGAAGAGGG - Intergenic
1086702166 11:89911507-89911529 TTGATAAGGCACAAGGAAGAGGG + Exonic
1086704001 11:89932943-89932965 TTGATAAGGCACAAGGAAGAGGG - Intergenic
1086709803 11:89993639-89993661 TTGATAAGGCACAAGGAAGAGGG + Intergenic
1087490319 11:98818264-98818286 TTTAAAAGGCATCAAGAAAATGG + Intergenic
1087600230 11:100305114-100305136 TTAAATTGGCATAAAGAAAGAGG - Intronic
1090152413 11:124399346-124399368 CTTCATAGGCATAAAGAAAAGGG + Intergenic
1091164885 11:133466774-133466796 GTGAAGAGGAAGAAAGAAGAAGG + Intronic
1091492129 12:941948-941970 TTTAAAAGGCTTAAATAAGAAGG + Intronic
1091673764 12:2472388-2472410 ATGAATAGGCTTAATGAAGATGG - Intronic
1092697902 12:11193763-11193785 TTTCATAGGCATAAGGAAGGGGG + Intergenic
1093541537 12:20292694-20292716 GTGAATAGGCACAAAGCACAAGG - Intergenic
1093869986 12:24279120-24279142 TTGACTTGACATAAAGATGATGG - Intergenic
1093957237 12:25235068-25235090 TGGAATTGGCAGAATGAAGATGG - Intronic
1094104095 12:26790852-26790874 TTGTTTAGGTATAAAGAAGGAGG - Intronic
1095750300 12:45703172-45703194 TTGAATAGGGAGAGAGAATAGGG - Intergenic
1097380620 12:58891508-58891530 TAGATTAGGAATCAAGAAGAAGG - Intronic
1097914926 12:65011086-65011108 ATGGATAGGCATGAAGAAGGCGG - Intergenic
1098734101 12:74075934-74075956 GTTAATAGGCAAAAAAAAGAAGG + Intergenic
1098796257 12:74891958-74891980 ATGAATAAAAATAAAGAAGAAGG + Intergenic
1099092600 12:78332228-78332250 TTAAAGAGGCATACAGATGAAGG + Intergenic
1099516030 12:83597651-83597673 GTGGATATACATAAAGAAGATGG + Intergenic
1099744602 12:86686374-86686396 TTGAATAGGAGTAAGGAAGAGGG + Intronic
1101012110 12:100461412-100461434 TTATACAGCCATAAAGAAGATGG - Intergenic
1101604469 12:106237552-106237574 TTGAATAGGCATAAAGAGGCTGG - Intergenic
1105435594 13:20375440-20375462 TTGAATAAACTAAAAGAAGATGG + Intergenic
1106611310 13:31284452-31284474 TTGAAAATGCTTCAAGAAGAGGG + Intronic
1106998064 13:35510616-35510638 TTGCAAAGGAATAAAAAAGAAGG + Intronic
1107300024 13:38955904-38955926 TTGAATAGATATAGAAAAGAGGG + Intergenic
1107356805 13:39576005-39576027 TTGAATTGTAATAAAGCAGAAGG - Intronic
1107456754 13:40562625-40562647 CTGAATAGGAATAGAGAAGCAGG - Intronic
1107578618 13:41755722-41755744 TTCATTGGGCAAAAAGAAGATGG - Intronic
1108159843 13:47627747-47627769 TTGGGTAGGGATAAAGAAAAAGG - Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1111171433 13:84531646-84531668 TTGATTAAGAAAAAAGAAGAGGG + Intergenic
1114557075 14:23568222-23568244 TTGACTAGAAAAAAAGAAGAGGG + Exonic
1114779094 14:25518363-25518385 TGGCATAGGCATAGAAAAGAAGG + Intergenic
1115202062 14:30864420-30864442 TGTAATGGGGATAAAGAAGATGG - Intergenic
1115368765 14:32588356-32588378 TTGCAAAAGCATAAATAAGAAGG - Intronic
1117452920 14:55868808-55868830 TTGAATAACCCAAAAGAAGAAGG - Intergenic
1117867624 14:60165748-60165770 CTGAATAGGAATGGAGAAGAGGG - Intronic
1119984169 14:79116902-79116924 TTGACAAGGCATGGAGAAGAAGG - Intronic
1120179193 14:81325852-81325874 CTGAGAAGGGATAAAGAAGAGGG + Intronic
1124667108 15:31602557-31602579 TTGAATAGGAATGGTGAAGAGGG - Intronic
1126598748 15:50407588-50407610 TGCAATAGGAATATAGAAGAAGG + Intergenic
1126896174 15:53259064-53259086 CTGAAGAGGCAGGAAGAAGAAGG + Intergenic
1126927738 15:53609373-53609395 TTGAACAGACATAGAGATGAGGG - Intronic
1127300877 15:57652288-57652310 TTTAATAAGCATGAAGAAAATGG - Intronic
1127999980 15:64181910-64181932 CTGAATAGTCATAAAGAGGAGGG + Intronic
1128828857 15:70747749-70747771 TTCAATAGGCAGAAAGATCAAGG - Intronic
1128916079 15:71563796-71563818 TTGAATATACTTAAAGGAGATGG - Intronic
1130301496 15:82682359-82682381 TGCAGTAGGAATAAAGAAGAAGG - Intronic
1132541995 16:514523-514545 CTGAAAGGGCATAGAGAAGATGG + Intronic
1137235898 16:46617777-46617799 TTGAGAATGCATAAAGCAGAGGG + Intronic
1138640336 16:58380816-58380838 TTGAACTGGCTTAAAGAAGAAGG - Intronic
1139115319 16:63944166-63944188 TCGAAAAGGCAAAAAGAAGAAGG - Intergenic
1139177202 16:64702245-64702267 TTGAAAATACATAGAGAAGAAGG + Intergenic
1140412669 16:74750584-74750606 TTGAATCAGCAAAAAGAAGTAGG - Intronic
1141049695 16:80749303-80749325 TTGAAAATGCATAAAGCAGTTGG + Intronic
1144874032 17:18387695-18387717 TTTAAGAGGCATAAATACGAAGG - Intronic
1145793723 17:27643809-27643831 TTGGAGAGACGTAAAGAAGAGGG - Intronic
1148530463 17:48385429-48385451 TTGGAGAGACATAATGAAGAAGG + Intronic
1149880922 17:60289358-60289380 TTGAAGAGTGCTAAAGAAGAGGG - Intronic
1149900892 17:60477120-60477142 GTTAATAGGCAGTAAGAAGAGGG - Intronic
1150472149 17:65446491-65446513 TTAAATGGGCACAAAGGAGATGG + Intergenic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1153316318 18:3725928-3725950 ATGAATACGAATAAAGAACAAGG + Intronic
1153361867 18:4206664-4206686 GTGAAGGGGCATAAAGAAGGAGG - Intronic
1153578138 18:6543520-6543542 GTGAATTGGCATAAAAATGAAGG + Intronic
1155562754 18:27097348-27097370 TTGAATAGGCATAGTGAGAATGG - Intronic
1156615077 18:38773206-38773228 TTCAGAAGGCATTAAGAAGAAGG - Intergenic
1156900720 18:42297694-42297716 TTGAATAGGCCTATAGGACAAGG - Intergenic
1157279701 18:46338236-46338258 TTAAATATGCACATAGAAGAGGG - Intronic
1157965181 18:52201084-52201106 CTGCCTAGGCATAAAGAAGTGGG - Intergenic
1158372489 18:56824609-56824631 TTAAATAGCCACTAAGAAGATGG - Intronic
1158922545 18:62209557-62209579 TTGAAAAGGAATAAAGATGGAGG - Intronic
1159346084 18:67206692-67206714 ATGAATAGGTATAAAGCAGGAGG - Intergenic
1159418326 18:68182818-68182840 TTGCTTAGGTATAAAGAATAAGG + Intergenic
1159482073 18:69002297-69002319 TTGTAGAGGCAGAAAAAAGAGGG + Intronic
1159597073 18:70392766-70392788 TGGAGGAGGCATGAAGAAGATGG - Intergenic
1159881202 18:73859987-73860009 TTGAATATGAAAAAAGGAGATGG + Intergenic
1163693642 19:18751212-18751234 TGCAACAGGCATAAAGAAAATGG + Intronic
1165547745 19:36555826-36555848 TTGGATAGGGAAAAAGCAGATGG - Intronic
1167670602 19:50851148-50851170 TTGGTTAGGCATAAATAAGCAGG - Intergenic
925237732 2:2293800-2293822 TTGAAAATGCACAAAGCAGAAGG + Intronic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926856609 2:17263261-17263283 TTGGATAGACATAGAGAAGTAGG + Intergenic
926881176 2:17544804-17544826 TTCACTATGCATAATGAAGATGG - Intronic
927333833 2:21897386-21897408 TTCATTAGCCATGAAGAAGAGGG + Intergenic
927947343 2:27144150-27144172 TTGACAAGGAATAAAGGAGAGGG - Intergenic
929241738 2:39660517-39660539 GTGAATAGGTAGAAAGAAGTGGG + Intergenic
930340602 2:50110039-50110061 TTTATTATGCATAATGAAGATGG + Intronic
930672944 2:54170737-54170759 TTGGATAGGCAAAAGGAAGGAGG + Intronic
931563696 2:63590875-63590897 TTGAATGAGCTTACAGAAGAAGG - Intronic
931847340 2:66218298-66218320 GTGAATAGGGATATAGAGGAGGG + Intergenic
932314877 2:70773379-70773401 TTGAATAGACGGAAAGGAGAGGG + Intergenic
932604541 2:73156450-73156472 TCGGATAGGAATACAGAAGAGGG - Intronic
933246987 2:79986730-79986752 TTGAGTGGAAATAAAGAAGATGG + Intronic
933447835 2:82404230-82404252 ATGCCTAGGTATAAAGAAGAAGG - Intergenic
933755572 2:85635653-85635675 CTGAAAAGGCATACAGAACAAGG - Intronic
934590183 2:95542645-95542667 TTGACAAGGCACAAAAAAGAGGG + Intergenic
935782329 2:106519086-106519108 TTGATGAGGCCTATAGAAGATGG - Intergenic
939156467 2:138530767-138530789 TTGGAAAGGCATAAAGAAAACGG - Intronic
939568100 2:143808510-143808532 TTGAACAGGTATGAAAAAGATGG + Intergenic
939618765 2:144391933-144391955 TGGACTGGGCATAAAGAATAAGG + Intronic
940397314 2:153204675-153204697 ATAGTTAGGCATAAAGAAGAAGG - Intergenic
940525144 2:154804532-154804554 TTCAATAGGAATACAGTAGATGG - Intronic
940577978 2:155538370-155538392 TTGAAAAAGGATAAAGATGAAGG - Intergenic
941083205 2:161086718-161086740 TTAAATAGGCTTCAAGAACATGG + Intergenic
941089897 2:161162258-161162280 TTGAAAAGGAAAAATGAAGAGGG - Intronic
941425220 2:165335938-165335960 TTGAATAGACATATTGAAAAAGG + Intronic
942185137 2:173417679-173417701 TTGAATAGGTATATAAAAGTTGG + Intergenic
942422187 2:175819808-175819830 TTGAATAGGACTAAAGGTGATGG - Intergenic
942682274 2:178489784-178489806 TTAAAAAGGCTTCAAGAAGAAGG - Intronic
943352227 2:186809108-186809130 TATAAGAAGCATAAAGAAGAGGG + Intergenic
944143113 2:196478276-196478298 TTGGACAGGCAGAAAGGAGAAGG + Intronic
945657210 2:212639464-212639486 TGGAAAAGTCATGAAGAAGAAGG - Intergenic
946767039 2:223050457-223050479 TTGAGTAGGCAGAAAGGAGGTGG - Intergenic
947972402 2:234335161-234335183 TTGAATATAAATAAAGAAGCAGG - Intergenic
1169049848 20:2566693-2566715 TTGAAAAGGTAGAAAGAAGAAGG + Intronic
1169136597 20:3201513-3201535 TTGCATAGCCACAAAGAAGGAGG + Intronic
1169921413 20:10737998-10738020 TTGACAAGGCAAAAAGGAGATGG - Intergenic
1172393098 20:34579760-34579782 GTGAGGAGGCACAAAGAAGAAGG - Intronic
1175146919 20:56904044-56904066 TTGACAAGGCAGGAAGAAGATGG - Intergenic
1177237270 21:18408712-18408734 TTAACTAGGCACAAAGGAGAAGG + Intronic
1182568303 22:31216225-31216247 TTAAATAGGCTTAAAGAAGGTGG + Intronic
1183014985 22:34978697-34978719 TACAATAGGAATAAAGTAGAGGG - Intergenic
949148673 3:737023-737045 TTGAAAAGACAGAAAGAAGTAGG + Intergenic
949302167 3:2596745-2596767 TTGAATAGTGATAAAGAGCATGG - Intronic
949668188 3:6366043-6366065 TTTGATAGGCATTAATAAGAGGG - Intergenic
951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG + Intergenic
953097340 3:39791531-39791553 ATGAATAGACAAAGAGAAGAAGG - Intergenic
953160290 3:40413225-40413247 TTGAATAGACTGAAAGCAGAAGG - Intronic
953201109 3:40779550-40779572 TTGAATGGGCAGAAACAACAAGG - Intergenic
953712945 3:45290358-45290380 TAGAAAAGCCATCAAGAAGAAGG + Intergenic
956347088 3:68292266-68292288 AGGAAAAGCCATAAAGAAGATGG - Intronic
956814058 3:72891733-72891755 ATGAAAAGTCATAAAGAAGAGGG + Intronic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
957843979 3:85706827-85706849 TTAAATAAGAATAAAGAAAAAGG + Intronic
957947471 3:87083385-87083407 TTGAATATGTATCAAGGAGAGGG - Intergenic
958932948 3:100226988-100227010 TTGCAGAGGCATTAAGAAGAAGG + Intergenic
959408338 3:105989421-105989443 TTGAATAGTAATAAAGTACATGG + Intergenic
959853753 3:111122915-111122937 GTGAACAGGAATAAAAAAGAGGG - Intronic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
960931944 3:122861079-122861101 TGGAAGAGGAAGAAAGAAGAAGG - Intronic
961922023 3:130436831-130436853 TTGCATAAGGATAGAGAAGAGGG - Intronic
962777224 3:138673298-138673320 TTGAAAAGGCACAATGAAAATGG + Intronic
963659748 3:148110335-148110357 TTGAATAGGTAAAAAGGACATGG + Intergenic
964077469 3:152708863-152708885 TTAAAAAGGCATAAAGGAGAAGG - Intergenic
965069605 3:163901770-163901792 TTCAATAACCATAGAGAAGAAGG - Intergenic
965267986 3:166572133-166572155 TTGAAGTGGAATAGAGAAGATGG + Intergenic
965910529 3:173769614-173769636 ATGAATTGGCATAAATAAAAAGG - Intronic
966332471 3:178829689-178829711 CTGAATAGGCATCAAAAAGTGGG + Intronic
966338524 3:178898994-178899016 TTGTACAGGCATGAAGAATATGG + Intergenic
968113933 3:196074583-196074605 TTAAAAAGGCATAAAGTGGACGG + Intronic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971733772 4:30419237-30419259 TTGAAAAAGAATAAAGAAGAAGG + Intergenic
972973994 4:44610839-44610861 GTGCATGGGAATAAAGAAGAGGG + Intergenic
973151198 4:46890320-46890342 TGGCATAGGCAAAAAGAATATGG - Intronic
974420860 4:61671611-61671633 TTGAATTGGCATACAGAAATTGG - Intronic
974569284 4:63624136-63624158 TTGAATAGTCATAAAGGAATTGG - Intergenic
974606956 4:64165197-64165219 TTGAACAAGCCTAAAGAAGCTGG + Intergenic
975422625 4:74185841-74185863 AAGAATAGTGATAAAGAAGAGGG + Intronic
975878934 4:78878699-78878721 TTGAGTAAGAAAAAAGAAGATGG - Intronic
976306155 4:83561444-83561466 TTGCAGAGGCAAGAAGAAGAAGG - Intronic
977595470 4:98874575-98874597 TACACTAAGCATAAAGAAGACGG - Intronic
978001170 4:103557600-103557622 CTGATTTGGCATAAAGAAAAAGG + Intergenic
978829233 4:113063396-113063418 TTGACTAGACACAGAGAAGAAGG - Intronic
979031212 4:115650270-115650292 GTGAACAGGCAGAAAGTAGAGGG - Intergenic
979776742 4:124598442-124598464 TTGAAGTGTCATACAGAAGAGGG + Intergenic
980081166 4:128345567-128345589 TTAAATAGGGATAATGATGATGG + Intergenic
980608773 4:135128287-135128309 TTAAATTGGCAAAAAGAAAAAGG + Intergenic
980752394 4:137108891-137108913 TTGACTGGGCAAAAAAAAGATGG - Intergenic
980794161 4:137659332-137659354 TTGAAAAGGAATAAATAAGAAGG - Intergenic
980801138 4:137751609-137751631 TTGGAGAGAGATAAAGAAGATGG - Intergenic
981239055 4:142452539-142452561 TTGAAGAGGTATAAAGAAACTGG + Intronic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
982666860 4:158276028-158276050 CTAAATAGGCATAAATAAAAGGG - Intergenic
982817342 4:159902852-159902874 GTGAGTAGGCAGAAAGCAGAGGG - Intergenic
982963288 4:161868841-161868863 CCCAAGAGGCATAAAGAAGATGG - Intronic
984550455 4:181153023-181153045 TTGCATAGCCATGAAAAAGAAGG - Intergenic
985887444 5:2690552-2690574 TTAAACAGGCACAGAGAAGACGG - Intergenic
987182173 5:15379639-15379661 TTTGAAAGGCAGAAAGAAGAAGG + Intergenic
988714101 5:33807821-33807843 GTTAATAGGCAAAAAGAAGCAGG + Intronic
988737145 5:34033793-34033815 TTATATAGTCATAAAAAAGAAGG + Intronic
988871230 5:35392301-35392323 CTGAATAGGCAGTAAGCAGATGG + Intergenic
989007238 5:36828439-36828461 TTGAAAAGGCCTAAAGAGGCTGG + Intergenic
989732219 5:44662806-44662828 ATTCATAGGCATAAAGAAGGTGG - Intergenic
990991701 5:61690632-61690654 TTGAATTGGCTCAAAGAATATGG + Intronic
992825265 5:80543288-80543310 TTGATTTGGCATAAAGAAAGAGG - Intergenic
993292069 5:86086265-86086287 AAGGATAAGCATAAAGAAGAAGG + Intergenic
993483188 5:88449994-88450016 TTGAACAGGCAGAAAGTAAATGG + Intergenic
994730592 5:103486527-103486549 TTGAATAGGCAAGAAAAAGGGGG - Intergenic
995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG + Intronic
996479295 5:123955567-123955589 TTCAATATGCAAATAGAAGAGGG + Intergenic
997421488 5:133770928-133770950 TTGGATAGTCATGCAGAAGAAGG - Intergenic
998355397 5:141531252-141531274 TTGACTTGGGATAAAGGAGAAGG - Intronic
1000756988 5:165173765-165173787 TTTAGTAGTCATAAACAAGAAGG + Intergenic
1000954493 5:167526704-167526726 TTGAATAGGAATTAGAAAGAAGG - Intronic
1003439980 6:6131546-6131568 TGCATTAGGCATAAAGAATAAGG - Intergenic
1003714125 6:8627151-8627173 TTCAATGGGGATAAAGAAGAGGG - Intergenic
1004849268 6:19680164-19680186 TTGAATATGTTTAAATAAGAGGG + Intergenic
1004868727 6:19881184-19881206 TTGAATAAGCGTAAAGATGCAGG + Intergenic
1005345673 6:24887624-24887646 TTGAAGAGGAATAAAAGAGAGGG - Intronic
1005574940 6:27181881-27181903 TTGAGTAGGCATATGGATGAAGG - Intergenic
1005686864 6:28261689-28261711 ATGATAAGGTATAAAGAAGAAGG + Intergenic
1007009662 6:38403405-38403427 TTAAAAAGGCATAAAGAATCTGG + Intronic
1007126500 6:39430150-39430172 GAGAAGAAGCATAAAGAAGAGGG - Intronic
1008449159 6:51629521-51629543 TTGGATAGGCATGATCAAGAAGG + Intronic
1008786987 6:55180349-55180371 ATGCATAGGCAAAAAGAGGAAGG + Intronic
1009304168 6:62066206-62066228 TTGAATAGGCTGAAAAAATAGGG - Intronic
1009537336 6:64905380-64905402 CTGAGTAGGAATAAAGAACAGGG - Intronic
1009803045 6:68567128-68567150 ATGAATCGGCAAAAAGAATAGGG - Intergenic
1009812077 6:68681072-68681094 GGGAATAGGCAGAAAGAAGAGGG + Intronic
1010024692 6:71201689-71201711 TTTAATAGGCCTTCAGAAGACGG - Intergenic
1010141356 6:72618613-72618635 ATGGGTAGGCATGAAGAAGAAGG + Intergenic
1010318393 6:74477288-74477310 TTTAATATGAATAAAGAACAAGG - Intergenic
1011648035 6:89478841-89478863 GTGAAGAGACATAGAGAAGATGG + Intronic
1013742805 6:113308037-113308059 TTAAATAGGGAAAAAGAATACGG + Intergenic
1013875402 6:114820463-114820485 TTGAATAGTAACAATGAAGATGG + Intergenic
1014815522 6:125931686-125931708 TTTAAAAGGCATCAAGGAGAGGG - Exonic
1015388230 6:132650759-132650781 TGGAATAGGCATAAAGAGATGGG - Intergenic
1015648667 6:135427509-135427531 TTGAAGAGGTAGAAAGTAGAAGG - Intronic
1015915120 6:138208567-138208589 TTGAATAGGGATAAATATAAAGG + Intronic
1018925769 6:168205964-168205986 CTGAACTGGCTTAAAGAAGAAGG - Intergenic
1019133029 6:169891141-169891163 TGGATTAGGGATAAAGATGAAGG + Intergenic
1021104999 7:16628037-16628059 TTGAATATGCACAAAGCATATGG - Intronic
1021239022 7:18177964-18177986 ATGAATAAGCAAAAAGAAAAGGG - Intronic
1021991227 7:26143215-26143237 TGGAAAAGGAATAAAGAAAAGGG - Intergenic
1022252790 7:28625483-28625505 TTATATAGTCAAAAAGAAGAGGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022709016 7:32834242-32834264 CTGATTTGGGATAAAGAAGAAGG - Intergenic
1022910850 7:34898611-34898633 GTGAATAGGCATGAGGAACAGGG - Intergenic
1023088212 7:36593605-36593627 GTTAATAGGCACAAGGAAGATGG - Intronic
1023221496 7:37923567-37923589 ATGAATAGTCATATTGAAGATGG + Intronic
1024954504 7:54902449-54902471 ATGAATAATCATAAAGAAGTAGG + Intergenic
1027717827 7:81696067-81696089 TTGATAAGGCTTCAAGAAGAGGG + Intergenic
1027977118 7:85172981-85173003 TAGAAAAGGCATAAGGAACAAGG + Intronic
1029447484 7:100621945-100621967 TTTAATAGGTACAGAGAAGAGGG - Intronic
1029806064 7:102997751-102997773 ATGATTAGGCATAAAAAAGAAGG - Intronic
1030064491 7:105648885-105648907 GTGATTAGACACAAAGAAGATGG - Intronic
1030685837 7:112486418-112486440 TTGAATACCAATAGAGAAGAAGG + Intronic
1032696700 7:134342951-134342973 TTGATTAAGAAGAAAGAAGAAGG - Intergenic
1033516456 7:142111533-142111555 ATGAACAGGGATACAGAAGAGGG + Intergenic
1034589385 7:152127160-152127182 GTGAATAAGAATAAAGAAAAAGG + Intergenic
1034821056 7:154216509-154216531 TTGAGGAGGGATAAAGGAGAAGG + Intronic
1035994262 8:4528320-4528342 TTTTATAGGAATAAAGAAGGTGG + Intronic
1036504294 8:9341389-9341411 TTTAAAAGACAGAAAGAAGATGG + Intergenic
1036568784 8:9961340-9961362 GTGATGAGGCATCAAGAAGAGGG + Intergenic
1037282956 8:17263993-17264015 TTAAATAGGCATGTAGAACATGG - Intronic
1039094419 8:33868120-33868142 GTGAATAGGGAGAAAGAATATGG + Intergenic
1039117657 8:34110555-34110577 CTGAATAGGCAAAATAAAGAAGG - Intergenic
1039766007 8:40628741-40628763 CTGAAATGGCATAAAGTAGAAGG + Intronic
1040669163 8:49666324-49666346 TTGAAAAGGCACAAAGTACAAGG - Intergenic
1041528102 8:58831462-58831484 TTGCATTGGCATAATGAATATGG + Intronic
1042341377 8:67683667-67683689 TTGAATAGGCATAAAGAAGAGGG - Intronic
1042439518 8:68809864-68809886 TTGTGTAGGCATAATAAAGATGG + Intronic
1043104624 8:76091620-76091642 TTGAATAAGGACAAAGATGAAGG - Intergenic
1043343138 8:79266391-79266413 TTCTACAGGCATAAAGAAAAAGG - Intergenic
1043534445 8:81186906-81186928 TTGAATAGGGATAATGTACATGG - Intergenic
1044312151 8:90706286-90706308 CTGAATAGGCAAAAGGTAGAAGG - Intronic
1044675517 8:94724468-94724490 TTAAAGAGGCATAATGAGGAAGG + Intronic
1044718292 8:95121478-95121500 TTGAAGAGGCACAAAGATGGTGG + Intergenic
1044930098 8:97244182-97244204 TTGAATAGGTTTTAAGAAGGGGG + Intergenic
1045677017 8:104618455-104618477 GTGAATTGGAATGAAGAAGAGGG + Intronic
1046334178 8:112761511-112761533 TTGACTAGGAAAATAGAAGAGGG - Intronic
1046580265 8:116083840-116083862 TTTAAAAGGCATATAGAATATGG + Intergenic
1046580270 8:116084029-116084051 TTTAAAAGGCATATAGAATATGG - Intergenic
1047661083 8:127037686-127037708 GTGAATAGGCAAATAGTAGATGG - Intergenic
1048384304 8:133897519-133897541 TTGAACTGGCCCAAAGAAGAGGG + Intergenic
1050022942 9:1303936-1303958 TTGAATAGGCAGAGAGGAGTGGG + Intergenic
1050051956 9:1611598-1611620 TTACATAGGCATAAAAAAAAGGG + Intergenic
1050701208 9:8341272-8341294 TTGAATAGGAAAAAAAAAAAAGG + Intronic
1051132440 9:13877300-13877322 GGGATGAGGCATAAAGAAGATGG + Intergenic
1052027607 9:23591075-23591097 TTTGATAGGCATAAGGAAGGAGG + Intergenic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1054896761 9:70322242-70322264 TTGAATAGGAATGAAGGAAAGGG - Intronic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1056053437 9:82794761-82794783 TACAATTGGCATACAGAAGATGG - Intergenic
1056204693 9:84308682-84308704 TTAAGTAGGAATATAGAAGATGG + Intronic
1056666595 9:88585976-88585998 GTGAAAGGGCAGAAAGAAGAAGG - Intergenic
1059571292 9:115439164-115439186 TGGAAAAGGCATAAAGTTGAAGG + Intergenic
1059685911 9:116635795-116635817 CTGAAAAGGCATTAAGAAAAGGG + Intronic
1060616768 9:125023769-125023791 TTCAATAAGCATACAGAAGTGGG + Intronic
1187266981 X:17743204-17743226 ATCAAAAGGGATAAAGAAGATGG - Intronic
1188336975 X:28948374-28948396 GTGAATGGGTCTAAAGAAGAGGG - Intronic
1189221971 X:39380191-39380213 TTTAATTGGCATATAGGAGATGG - Intergenic
1189941543 X:46128369-46128391 ATGAATAGGCAAAAATAAAAAGG + Intergenic
1190515691 X:51221688-51221710 TTGGATGGGCAGAGAGAAGAAGG - Intergenic
1193817431 X:86121188-86121210 TTGAACAAGCAGAAAAAAGAAGG - Intergenic
1194333205 X:92611619-92611641 TTGAATAGGAGTACTGAAGATGG + Intronic
1194594744 X:95843142-95843164 TTGTATAGCCCTAAAGAATATGG - Intergenic
1195878624 X:109569399-109569421 TTAAATAAGCATATAGAGGATGG + Intergenic
1196366125 X:114926216-114926238 TTGAGGAGGCATAAAGCAGAAGG - Intergenic
1197636091 X:128916398-128916420 TTGAATAGACATAGGTAAGAGGG + Intergenic
1198013720 X:132587314-132587336 CTAAATAGGCATAAATAAAAGGG + Intergenic
1198541941 X:137649135-137649157 TTGAATAGGCATTTAGCAAAAGG + Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199899360 X:152157957-152157979 TTGGAAAGGAATAAAGATGAGGG + Intergenic
1200641890 Y:5730641-5730663 TTGAATAGGAGTACTGAAGATGG + Intronic
1201345002 Y:12973559-12973581 TGGAATAGTCATAAATATGATGG + Intergenic
1201770907 Y:17615811-17615833 GAGAATGGGCATCAAGAAGAGGG - Intergenic
1201830648 Y:18290175-18290197 GAGAATGGGCATCAAGAAGAGGG + Intergenic