ID: 1042342421

View in Genome Browser
Species Human (GRCh38)
Location 8:67694359-67694381
Sequence GACAGCTCTTGGCCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042342418_1042342421 11 Left 1042342418 8:67694325-67694347 CCATTTTCTGCAGATAACTACTT 0: 2
1: 17
2: 222
3: 216
4: 408
Right 1042342421 8:67694359-67694381 GACAGCTCTTGGCCTGCTGCTGG No data
1042342417_1042342421 16 Left 1042342417 8:67694320-67694342 CCTTGCCATTTTCTGCAGATAAC 0: 12
1: 195
2: 171
3: 143
4: 299
Right 1042342421 8:67694359-67694381 GACAGCTCTTGGCCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042342421 Original CRISPR GACAGCTCTTGGCCTGCTGC TGG Intronic
No off target data available for this crispr