ID: 1042344840

View in Genome Browser
Species Human (GRCh38)
Location 8:67716873-67716895
Sequence GCCAACTGCTCCACAAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042344839_1042344840 4 Left 1042344839 8:67716846-67716868 CCAGCTGTTCATAGTAGCTGAAA 0: 1
1: 0
2: 1
3: 7
4: 123
Right 1042344840 8:67716873-67716895 GCCAACTGCTCCACAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042344840 Original CRISPR GCCAACTGCTCCACAAATGC AGG Intronic
No off target data available for this crispr