ID: 1042346031

View in Genome Browser
Species Human (GRCh38)
Location 8:67728945-67728967
Sequence TGTCCAAGAATTAAATTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042346031_1042346034 -8 Left 1042346031 8:67728945-67728967 CCACCCAATTTAATTCTTGGACA 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1042346034 8:67728960-67728982 CTTGGACATTATAGAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042346031 Original CRISPR TGTCCAAGAATTAAATTGGG TGG (reversed) Intronic
900859562 1:5218376-5218398 TGTCTGTGAAATAAATTGGGAGG + Intergenic
902980246 1:20117591-20117613 AGTCCATGAATTCAAGTGGGAGG + Intronic
905809498 1:40901838-40901860 TGTCCAAGGATCACATCGGGTGG + Intergenic
907168710 1:52440178-52440200 TGTTCTAAAATTAAATTGTGGGG + Intronic
908038248 1:60079370-60079392 ACTCCAACAAATAAATTGGGAGG + Intergenic
909684230 1:78328624-78328646 TGTCAAAGAAATATATTTGGGGG - Intronic
909748891 1:79134535-79134557 TGTAAGAGAATTAAATTGGCGGG + Intergenic
912079618 1:105918968-105918990 AATCCAAGAATTCTATTGGGAGG - Intergenic
918971230 1:191422104-191422126 TTTTCATGAATGAAATTGGGAGG - Intergenic
921310692 1:213840231-213840253 TGACCTTGTATTAAATTGGGAGG - Intergenic
921401863 1:214733426-214733448 TGTCTAAGAATGAAATTGCTAGG + Intergenic
921480140 1:215655547-215655569 TCTCCTAGAATAAAATTAGGAGG - Intronic
923052779 1:230400299-230400321 TGTTGCAGAATTAAATAGGGTGG - Intronic
1066932818 10:41786742-41786764 TATCCCAGGATTAAATTAGGAGG + Intergenic
1074138669 10:110651107-110651129 CTTCCAAGAATAAAATTAGGTGG + Intronic
1079712354 11:23701572-23701594 TGTCCATTAATTACATTTGGTGG - Intergenic
1080334439 11:31180382-31180404 TATCAAAACATTAAATTGGGGGG + Intronic
1081417523 11:42833777-42833799 TTTTCAAGAATGAAATTGGCTGG - Intergenic
1087687322 11:101279820-101279842 TGAGCAAGAATTAAATAGGTAGG - Intergenic
1087952284 11:104237532-104237554 AGTCCAAGATTTAAATGGAGAGG + Intergenic
1089780142 11:120868009-120868031 TGTCCTGGTATTATATTGGGGGG + Intronic
1090885726 11:130874608-130874630 TGGACAAGAATTAAATTATGAGG - Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1093064228 12:14639885-14639907 TTTCCAAGAATAAATCTGGGCGG + Exonic
1101677819 12:106935535-106935557 TGCTCAAGAATTAAAATGAGGGG - Intergenic
1105053051 12:133072100-133072122 TCTCTAATAATTAAATTGGCTGG - Intergenic
1106701972 13:32238864-32238886 TGACTAAGACTTAAATTGGTTGG + Intronic
1107030491 13:35847518-35847540 AGTCCAAGAATTAAAATATGTGG + Intronic
1108854033 13:54771537-54771559 TGACCAAGGATTAAATTATGTGG - Intergenic
1109402293 13:61849928-61849950 TATCTAAGAATGAAATTGGAGGG - Intergenic
1109850372 13:68055883-68055905 TGAGGAAGAAATAAATTGGGAGG - Intergenic
1110470324 13:75853118-75853140 TCTCCAAGAATTGGATCGGGGGG - Exonic
1112170121 13:96962768-96962790 TGTCGAAGAACATAATTGGGTGG - Intergenic
1115532760 14:34342340-34342362 TGTCAAAGAAATATATTTGGGGG - Intronic
1119539089 14:75427486-75427508 TGTCCAAGGATGAAACTGTGCGG + Intergenic
1121328310 14:93034482-93034504 TCTCCAAGAATAGAATGGGGAGG + Intronic
1124258415 15:28164749-28164771 TGTCTCATAAATAAATTGGGGGG + Intronic
1124831869 15:33156689-33156711 TGTCCAAGAACTCACTTAGGAGG + Intronic
1126128945 15:45321911-45321933 TGCCTGAGAATTAAATTGAGAGG + Intergenic
1126260223 15:46680940-46680962 TGTCAAAGAAATATATTTGGGGG - Intergenic
1129353369 15:74970717-74970739 TCTCCAAAAAATAAAATGGGCGG - Intronic
1130459174 15:84146776-84146798 TGTCTAAGTCTTAAATTGGTAGG - Intergenic
1130872372 15:87981651-87981673 GGTCCAAGAAGGAAAATGGGGGG - Intronic
1132062985 15:98707958-98707980 TGTCCAATAACTACATTGTGGGG + Exonic
1135118040 16:19740235-19740257 TGGACAAGAATTAAATTGTCAGG - Intronic
1135811305 16:25589118-25589140 TGTCCAAGAAATATATTTTGGGG - Intergenic
1138822603 16:60280000-60280022 TGACCAAGAATGAAATTGGAAGG + Intergenic
1140615883 16:76663161-76663183 TGTACAAAAATTAAATTGTTTGG + Intergenic
1142544703 17:692232-692254 TTCCCAAGAATTAAAATGGATGG - Intronic
1143686148 17:8517675-8517697 TGGCCAAGAATAGAATTGGGAGG - Intronic
1145036385 17:19543607-19543629 TGTCCAAACTTAAAATTGGGAGG + Intronic
1149667823 17:58378193-58378215 TTTCCACGAATCAAGTTGGGAGG + Intronic
1155785489 18:29894332-29894354 TGTACAAGAAAGAAATTGGGGGG + Intergenic
1156165262 18:34412485-34412507 TGTTCTGGAATTAAATTGTGGGG - Intergenic
1157184307 18:45525033-45525055 TGTTCTAGATTTAAATAGGGAGG - Intronic
1157470876 18:47987364-47987386 TATACAAGAATAAAACTGGGCGG + Intergenic
1159619466 18:70620691-70620713 TGTCAAAGAAGTACATTTGGTGG - Intergenic
1160415582 18:78707659-78707681 TGTCTAAGAATGCAATTGCGGGG + Intergenic
1163008093 19:14408787-14408809 TGACCAAGAAATAGATGGGGTGG + Intergenic
1163296739 19:16417634-16417656 TGTCCTAGAATTGAATTCAGAGG + Exonic
1166913563 19:46178411-46178433 TGTCAAAGAATTATATTTTGGGG - Intergenic
1167718955 19:51164569-51164591 TTTACAGGAATTAAATAGGGAGG + Intergenic
926250137 2:11150742-11150764 TATTCAGGAATTAAAATGGGAGG - Intergenic
926347827 2:11965252-11965274 TATCTAAGTATTTAATTGGGGGG + Intergenic
930275882 2:49310604-49310626 TGTCCAAGCATAAAATGAGGAGG + Intergenic
930664369 2:54087636-54087658 TATTCAAGAATGAAATTAGGTGG - Intronic
931602387 2:64018185-64018207 TTTCGAAGAATTAAATTGTTTGG - Intronic
933056308 2:77671714-77671736 TGTACAAGAATTGAATTAGAGGG - Intergenic
933927862 2:87116029-87116051 TGTACAAGAATTGAATTAGAGGG - Intergenic
935823828 2:106921463-106921485 AGTCTAAGAATTAAATTGACAGG + Intergenic
936035006 2:109104156-109104178 TGTCAAAGAAATATATTTGGGGG + Intergenic
936293842 2:111249689-111249711 TTTTCAAGAGTTAAATTGAGGGG - Intergenic
938198299 2:129352260-129352282 TGAGCAAGAATAAAATTGGAGGG + Intergenic
939859791 2:147405339-147405361 TGTACAAGTATAAAATTTGGGGG + Intergenic
940190516 2:151035970-151035992 TGTCAAAGAAATATATTTGGGGG - Intronic
942662885 2:178284814-178284836 TGTTCAAAAGATAAATTGGGAGG + Intronic
943254950 2:185583196-185583218 TGGCCAAGAATAAATTTGGATGG + Intergenic
945601079 2:211865368-211865390 GCTCCAAGAAATAAGTTGGGAGG - Intronic
945839715 2:214873037-214873059 TGAGCAAGAATTAAACTTGGTGG - Intergenic
948754709 2:240152112-240152134 TGTCCATGAAACAAAATGGGAGG + Intergenic
1169083602 20:2813814-2813836 TGTCCAGGAATGCAATTGTGTGG + Intergenic
1169761926 20:9104892-9104914 TGTACAAGACAGAAATTGGGAGG - Intronic
1170154630 20:13258167-13258189 TGCCCAAGAAATAAATAGGATGG - Intronic
1170621209 20:17997825-17997847 TGAACAAGAATCAAAGTGGGTGG - Intronic
1172783653 20:37451838-37451860 TGTCCAAGAAGGACAATGGGTGG - Intergenic
1174072261 20:47907602-47907624 TCTCCATGAATTAACGTGGGAGG - Intergenic
1174862239 20:54101983-54102005 TTGCCAAGAATTAAATGGAGAGG + Intergenic
1184298454 22:43541054-43541076 TGTGCAAAAATCAAATTGGAAGG - Intronic
950721445 3:14885579-14885601 TGTCCGAGACTTAAGCTGGGAGG + Intronic
951404452 3:22278471-22278493 TGTCCATGAATTATCTGGGGTGG + Intronic
952172873 3:30828463-30828485 TCTCCAAAAATAAAAGTGGGGGG + Intronic
953696293 3:45162538-45162560 TGTCAAAGAAGTATATTGTGGGG - Intergenic
956931290 3:74046281-74046303 TGTCCAAAAATTCATGTGGGTGG + Intergenic
957819894 3:85358489-85358511 TATCCAAGAATTCAATTGGTGGG + Intronic
957824836 3:85427291-85427313 AGTCCAATAATTAAACTGGGTGG + Intronic
957851328 3:85811110-85811132 TGTCCAAAAATTAAAATTTGTGG - Intronic
957877021 3:86160509-86160531 TTTCCAGGAAATAAATTGGATGG - Intergenic
958539105 3:95447215-95447237 AGGCCTAGAATTAAATTGTGAGG - Intergenic
958868001 3:99523895-99523917 TGTGCAAGAATTAAACTTAGAGG - Intergenic
959707765 3:109355000-109355022 TTTAAAAGTATTAAATTGGGAGG - Intergenic
961323070 3:126091773-126091795 TGTCAAAGAAATACATTTGGGGG + Intronic
962119459 3:132546213-132546235 TGTCAAAGAAGTATATTTGGGGG + Intergenic
963646376 3:147919474-147919496 TGTGCAATAATTAAAATGGCTGG + Intergenic
963717557 3:148821368-148821390 TGTCAAAGAAGTATATTTGGGGG + Intronic
964711812 3:159679082-159679104 TTTGTGAGAATTAAATTGGGAGG - Intronic
965642537 3:170845446-170845468 TTTCCAATAATTGAATTGTGAGG - Intronic
966817124 3:183898432-183898454 AGTCCTAGAATCAAATTGGCAGG + Intergenic
969131171 4:4992030-4992052 TGTCCAGGAATGAAATTGGCTGG - Intergenic
970244042 4:14039997-14040019 TGTCAAAGAAATACATTGTGGGG + Intergenic
970246062 4:14065084-14065106 TGTCCAAGAATGGAATTTTGGGG - Intergenic
973235924 4:47904371-47904393 TTTCCAAGAACAAAATTGAGAGG + Intronic
974406184 4:61473589-61473611 TGTACAAGAAATAAATGAGGAGG + Intronic
975229145 4:71910359-71910381 TATCCAAAAATTAAATTAAGTGG - Intergenic
975719919 4:77239494-77239516 CCACCAAGAATTAAATTTGGTGG - Intronic
978295270 4:107197524-107197546 GATTCAAGAATTAAATTTGGAGG - Intronic
980229076 4:130024714-130024736 TTTCCCAGAATAACATTGGGTGG + Intergenic
982248967 4:153385180-153385202 TGTCCAAGAATAAGAGTGGCTGG - Intronic
982299818 4:153867311-153867333 TGTTCAAGAAGTGACTTGGGTGG + Intergenic
982703095 4:158677583-158677605 TGTCCAAGAAATATATTTTGGGG + Intronic
991030213 5:62074663-62074685 TGTCAAAGAAATACATTTGGGGG + Intergenic
991628478 5:68629672-68629694 TGTCCAAGAATTATATTTTGGGG - Intergenic
994232509 5:97324149-97324171 TGTGATACAATTAAATTGGGAGG - Intergenic
997043048 5:130280047-130280069 TGTCCTAAAATTATTTTGGGAGG - Intergenic
1001442440 5:171754394-171754416 TGTCCCAGAATAAAAAAGGGAGG - Intergenic
1003021458 6:2513482-2513504 TGTCCAAGAATTATAGAGGATGG - Intergenic
1003833176 6:10037512-10037534 TCTCCAAGAAATAAAGTGGGGGG - Intronic
1008884691 6:56419468-56419490 GGTCCAAGAAGTAAAATGTGAGG - Intergenic
1014252474 6:119128774-119128796 TGTCAAAGAAATATATTTGGGGG - Intronic
1015764507 6:136701582-136701604 GGTAAAAGGATTAAATTGGGCGG - Intronic
1019068485 6:169322457-169322479 TGTCAAAGAAATATATTTGGGGG + Intergenic
1020847375 7:13304163-13304185 TACCCAAGAATTAAATTGAGTGG + Intergenic
1022616598 7:31937290-31937312 TGTCAAAGAAATATATTGTGGGG + Intronic
1023345482 7:39267061-39267083 TGACCAAGAATTATTTTGGAGGG + Intronic
1023376366 7:39559921-39559943 TTTCAAAGTATTAAATTGGCTGG + Intergenic
1024035167 7:45501773-45501795 TGTCAAAGAAATAAATCTGGGGG - Intergenic
1024366522 7:48526965-48526987 TATACAAAAATGAAATTGGGAGG - Intronic
1026247359 7:68633176-68633198 TGTCAAAGAAATATATTTGGGGG + Intergenic
1027621207 7:80487691-80487713 TTTCCAAGAATTACGTTGGTAGG + Exonic
1029345202 7:99973460-99973482 TGTCCATGAATTCAATTGTAGGG - Intronic
1029568509 7:101355748-101355770 TGTCTAAAAATAAAATTGGCTGG + Intergenic
1030560900 7:111084703-111084725 TGTGCAATAACCAAATTGGGAGG + Intronic
1032674273 7:134114051-134114073 TGTCAAAGAAATATATTTGGGGG - Intergenic
1033854110 7:145535657-145535679 TGTTAAAGAATAAAATTGGAGGG + Intergenic
1036508049 8:9374070-9374092 TGTCCAAGAATATAATTGCTTGG - Intergenic
1036919800 8:12841294-12841316 TGTCCCAGAGATAAATAGGGTGG + Intergenic
1039799393 8:40941193-40941215 TGTCAAAGAAATATATTTGGGGG + Intergenic
1041607798 8:59804274-59804296 TGTCCAAGAGTGAAATTGATGGG + Intergenic
1041967248 8:63693680-63693702 TCTCCTAGAATAACATTGGGTGG - Intergenic
1042346031 8:67728945-67728967 TGTCCAAGAATTAAATTGGGTGG - Intronic
1043513517 8:80974687-80974709 TGACAAAGAATATAATTGGGAGG - Exonic
1043810584 8:84734220-84734242 TGTCAAAGATTTAAATTAAGGGG - Intronic
1045290812 8:100831092-100831114 TGTCAAAGAAATATATTTGGGGG + Intergenic
1046890146 8:119414005-119414027 GTTCCAGGAATTAAATTGGATGG - Intergenic
1047295275 8:123565193-123565215 TTTCCAATAAGAAAATTGGGAGG - Intergenic
1047522509 8:125606063-125606085 TGTCCAAGAAATATATTTGGAGG + Intergenic
1048545300 8:135381235-135381257 ACCCCAAGACTTAAATTGGGTGG - Intergenic
1049027611 8:140006049-140006071 TATTCAAGAAATAAATTAGGAGG + Intronic
1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG + Intergenic
1050689083 9:8204874-8204896 TTTCGAAGAATTAATTGGGGTGG + Intergenic
1050719654 9:8571964-8571986 TGTGAAAGAATTAAAGTTGGTGG + Intronic
1052472375 9:28916234-28916256 TGTCAAAGAAACAAATTCGGGGG - Intergenic
1054724265 9:68634635-68634657 TGTCCAAGTAGTTTATTGGGAGG - Intergenic
1055029450 9:71758788-71758810 TGTCAAAGAAATATATTTGGGGG + Intronic
1057580052 9:96279674-96279696 TGTCAAAGAAATACATTTGGGGG + Intronic
1188061172 X:25603767-25603789 TGTCAAAGAAATATATTTGGGGG - Intergenic
1188482159 X:30647243-30647265 TGACCAAGAATTAGATTGTGAGG + Intergenic
1188773623 X:34186088-34186110 TGTCCATGAGTTAAATTGTTTGG + Intergenic
1190981574 X:55460796-55460818 CATCCAAGTCTTAAATTGGGAGG + Intergenic
1190987124 X:55512384-55512406 CATCCAAGTCTTAAATTGGGAGG - Intergenic
1193972184 X:88068120-88068142 TGTCAAAGAAATATATTTGGGGG + Intergenic
1197616318 X:128695724-128695746 TTTCCAGGAAATAAAATGGGAGG + Intergenic
1198845592 X:140907018-140907040 TGTCAAAGAAATATATTTGGGGG - Intergenic
1199761200 X:150905395-150905417 AGTTGAAGAATTAAATAGGGAGG - Intergenic
1201461851 Y:14234132-14234154 TGTCCAAGAAATAAATACTGAGG - Intergenic
1201889970 Y:18931932-18931954 TTTCCAAGAAAAATATTGGGAGG - Intergenic