ID: 1042346831

View in Genome Browser
Species Human (GRCh38)
Location 8:67736146-67736168
Sequence CAGGAAAGTGAGATGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 1, 2: 2, 3: 40, 4: 513}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042346831_1042346835 -2 Left 1042346831 8:67736146-67736168 CCTGACTCCATCTCACTTTCCTG 0: 1
1: 1
2: 2
3: 40
4: 513
Right 1042346835 8:67736167-67736189 TGTGGTCTTTCCTTTATCACTGG No data
1042346831_1042346839 28 Left 1042346831 8:67736146-67736168 CCTGACTCCATCTCACTTTCCTG 0: 1
1: 1
2: 2
3: 40
4: 513
Right 1042346839 8:67736197-67736219 CTTTCCTTATTTCTACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042346831 Original CRISPR CAGGAAAGTGAGATGGAGTC AGG (reversed) Intronic
901584851 1:10280880-10280902 ATGGAAACTGAGAAGGAGTCAGG - Intronic
901685148 1:10939589-10939611 CAGGGAAGGGGGATGGAGGCAGG + Intergenic
901775551 1:11558431-11558453 CTGCAAAGTGAGAGGGAGGCGGG - Intergenic
903035645 1:20490999-20491021 CAGGAATGTGAAACGGAGTGAGG - Intergenic
903224945 1:21889214-21889236 CAGGGAACTGAGATGGAGACAGG + Intronic
903395318 1:22997607-22997629 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
903880164 1:26502731-26502753 CAGGAGAATGAGATGGAGAAAGG - Intergenic
904435068 1:30489517-30489539 CAGGAAAGTGAGCTGATCTCAGG - Intergenic
905916476 1:41688119-41688141 CTGGGAAGTGATATGGGGTCAGG + Intronic
906049671 1:42859760-42859782 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
906081386 1:43091038-43091060 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
906414219 1:45607431-45607453 CAGGACAGTGAAATGGAGAAGGG + Exonic
907824654 1:58003869-58003891 CATAAAAGAGAGATGGATTCTGG - Intronic
908496193 1:64697357-64697379 CAAGAAAGTCAGATGGTTTCTGG - Intergenic
909232511 1:73107793-73107815 AAGTAAAGTGAGATGGAATTTGG + Intergenic
910243709 1:85116064-85116086 CAGCAAGGTGAAATGGAGCCAGG - Intronic
912010729 1:104958155-104958177 CACGAAAGTGTGATGGACTGGGG + Intergenic
913039820 1:115011430-115011452 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
913698111 1:121347572-121347594 CAGCAAGTTGAGATGGGGTCAGG - Intronic
914139439 1:144932480-144932502 CAGCAAGTTGAGATGGGGTCAGG + Intronic
914443157 1:147724338-147724360 AAGGAAACTGAGGTGGAGTGAGG - Intergenic
915480086 1:156178521-156178543 CAGGAAAGAGAGACTGAGTGGGG - Intergenic
915767347 1:158376459-158376481 CAGGCAACTGAGATTGAATCAGG + Intergenic
916163060 1:161938920-161938942 CAGAAAAGTGAGCTGGTGACTGG - Intronic
916646583 1:166792599-166792621 CAGGAAAATGGGATGGAGCCAGG + Intergenic
916942301 1:169688600-169688622 CAGCAAAGGGAGATGGGGTGGGG - Intronic
917067878 1:171116695-171116717 CAGAAAAGTGAGAATGAATCTGG + Intronic
917092947 1:171372262-171372284 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920460412 1:206135327-206135349 CAGGAAAGGGAGATGAGGTAGGG + Intergenic
920485506 1:206366222-206366244 CAGCAAGTTGAGATGGGGTCAGG - Intronic
920528947 1:206687767-206687789 CAGGAGAGGAAGATGGAGTGGGG + Intronic
921196024 1:212759244-212759266 CAAGAAAGTGAGATGGGGAGGGG + Intronic
921669984 1:217914572-217914594 CAGCAAAGTGAGATGGAGAAGGG - Intergenic
923074888 1:230601523-230601545 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
923183082 1:231541989-231542011 CAGGAAACTTAGGTGGAGCCTGG - Intronic
923245567 1:232128494-232128516 CAGGAAAGAAAGATTGAGGCAGG - Intergenic
923348869 1:233083989-233084011 AAGGAAAATGAAATGGGGTCAGG + Intronic
923458794 1:234188787-234188809 CAGGGGAGTGAAATGGACTCTGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924539207 1:244965422-244965444 CAGGACAGTGAGAGGGAGGGAGG - Intergenic
1063144891 10:3288155-3288177 AAGGAAACTAAGCTGGAGTCCGG - Intergenic
1063320670 10:5049905-5049927 CTGGAAAGTTCCATGGAGTCAGG - Intronic
1063326234 10:5105888-5105910 CTGGAAAGTTCCATGGAGTCAGG - Intronic
1064271906 10:13872889-13872911 AAGGATAGTTAGATGGAGCCTGG + Intronic
1064728186 10:18302245-18302267 CAGGGAAGTTTGATGGGGTCAGG + Intronic
1068360524 10:55971776-55971798 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1069515455 10:69073504-69073526 CAGGAAAGAAAGATGAAGTGAGG + Intergenic
1070491296 10:76979321-76979343 CAGAAAAGAGAGCTGGGGTCAGG + Intronic
1070598586 10:77849722-77849744 CAGGAAAGGGAGAGGGGGACAGG + Intronic
1071729170 10:88231000-88231022 AAGGAAAGGGATATGGAATCAGG - Intergenic
1072010805 10:91301449-91301471 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1072011630 10:91307021-91307043 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1072450535 10:95536186-95536208 CAACAAAGTGAGATTGATTCAGG + Intronic
1073625192 10:105089702-105089724 CAGCAAAGTGGGATGCACTCAGG - Intronic
1074289560 10:112128138-112128160 CAGGAATGTGAGTTGGAGTGGGG - Intergenic
1074693339 10:116026475-116026497 CAGGGAATGCAGATGGAGTCTGG + Intergenic
1075267710 10:121018360-121018382 AAGGAAACTGAGATGGAATGAGG - Intergenic
1076436021 10:130442070-130442092 GAGGAAACTGAGATGCAGACAGG - Intergenic
1076563225 10:131381123-131381145 GAGGCCAGTGAGATGGAGGCTGG + Intergenic
1076768524 10:132650796-132650818 CATGAAAATAAGAGGGAGTCCGG + Intronic
1077264191 11:1641012-1641034 CAGGAAAATGAGATGGCTACAGG - Intergenic
1077303447 11:1857397-1857419 CAGGGAACTGAGGTGGAGACAGG - Intronic
1078182314 11:9022392-9022414 CAGGTAAGTGAGATGGAAGCTGG - Intronic
1078375804 11:10792300-10792322 CAGGTAAGTCAGATAGAGCCTGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079457213 11:20646770-20646792 CAGGAAGGTGAGGTGGTGGCAGG - Intronic
1080466056 11:32498360-32498382 CAGGAAAGAGAGACAGAGTAGGG + Intergenic
1080468973 11:32526574-32526596 CTGGAAAGTGGGATGGATTGTGG + Intergenic
1080615837 11:33944029-33944051 AAGGAGACTGAGATGGAGACAGG - Intergenic
1082954309 11:58852557-58852579 CAGGAAATTGAGATAGAGATAGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083254482 11:61487731-61487753 CAGGGCAGTGCGAGGGAGTCTGG + Intronic
1083353055 11:62044819-62044841 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1083534256 11:63454078-63454100 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1083567029 11:63727817-63727839 GAGGAAAGTGAGAGAGAGACTGG + Intronic
1084029863 11:66475098-66475120 GAGGAAACTGAGATGGAGAGAGG + Intronic
1084233493 11:67770369-67770391 CTGGCAAGTGAGATGGATGCTGG + Intergenic
1084353705 11:68623078-68623100 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1084355229 11:68634049-68634071 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1084572634 11:69968762-69968784 CACGAAAGAGAGGTGGAGGCTGG - Intergenic
1084585261 11:70057527-70057549 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1085695720 11:78702851-78702873 AGGGAAAGGCAGATGGAGTCTGG + Intronic
1085814132 11:79717763-79717785 CAGGAGAGTGAGAGGGAGAAAGG + Intergenic
1085901075 11:80700292-80700314 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1086125572 11:83345287-83345309 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1086234676 11:84614570-84614592 CAGTAAAGTGAACTGTAGTCAGG + Intronic
1086341044 11:85848795-85848817 CAGGACAGTAAGCTGGAGCCAGG - Intergenic
1086549926 11:88043679-88043701 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1087013314 11:93533387-93533409 CAGGAAAGAGACATGGTGTTAGG - Intronic
1089777195 11:120846555-120846577 CAGGAGAGTGTGATGGAGAGAGG + Intronic
1090249277 11:125240143-125240165 CGGAAGAGTGAGATGGAGTGGGG + Intronic
1090698333 11:129271286-129271308 GAAAAAAGTGAGATGTAGTCAGG + Intronic
1091583623 12:1803437-1803459 CAGGAATCTGGGATGGAGTCAGG + Intronic
1092416468 12:8293843-8293865 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1094401266 12:30062394-30062416 CAGGGAAGGGAGATGGGGTGGGG - Intergenic
1094744645 12:33331079-33331101 GAGGAAAGTGAAATGGAATTTGG - Intergenic
1095116729 12:38363073-38363095 CAGGACAGTCTGATGGAGACTGG - Intergenic
1095534275 12:43227660-43227682 CAGGAAACAGAGATGGATACGGG + Intergenic
1095968348 12:47884131-47884153 CAGGAAGGTGAGGTGGGGACCGG + Intronic
1096571393 12:52525399-52525421 CAGGAAAGCCAGATGGAATAAGG - Intergenic
1097124888 12:56766190-56766212 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1097346358 12:58497883-58497905 CAGGAAACTGAGGTGGAGAGTGG + Intergenic
1098437329 12:70481766-70481788 CAGGACAGTGATATGGAGAAGGG + Intergenic
1098654163 12:73007418-73007440 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1099257491 12:80331865-80331887 GAGGCAAGAGAGTTGGAGTCAGG + Intronic
1100277726 12:93086627-93086649 CAGGAACATGGGATGGGGTCAGG + Intergenic
1100570930 12:95842367-95842389 CGGGAAAGGGAGAGGGAGACGGG + Intergenic
1100675993 12:96868713-96868735 TAGAAAAGTAAGATGGAGCCAGG + Intronic
1102345595 12:112159167-112159189 CAGGAAAGTGGGCTGAAGCCAGG - Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1103018365 12:117513694-117513716 TAAGAAAGTGGGATGGACTCAGG + Intronic
1103172309 12:118832232-118832254 CAGGAAAGTGTGTGGGAGGCAGG - Intergenic
1104189180 12:126461831-126461853 CAGGAAAATGAGTTGGAACCAGG - Intergenic
1104337235 12:127910793-127910815 AAGGTAAATGAGATGGAGACAGG - Intergenic
1104409066 12:128543047-128543069 AAGGAAAGTGAAATTGAGGCTGG + Intronic
1105896309 13:24719422-24719444 CAGGAGTTTGAGATGGACTCTGG + Intergenic
1105926224 13:25011272-25011294 GAGGAAAGTGAGGTGGTGGCAGG + Intergenic
1106038761 13:26069705-26069727 GAGGAAAGTGAGGTGGCGGCAGG - Intergenic
1106874254 13:34054746-34054768 CTGGAAAGGGAGCTGAAGTCAGG - Intergenic
1107591060 13:41906314-41906336 CAGAAGTGTGAGTTGGAGTCTGG - Intronic
1107711788 13:43157810-43157832 CAGAACACTGAGATGGAGTTAGG + Intergenic
1108422411 13:50264810-50264832 GAGGAATGTGAGATGGGGTACGG + Intronic
1108956545 13:56165884-56165906 CAGGAGAAAGAGATGGAGTGGGG + Intergenic
1109422526 13:62132042-62132064 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1110039757 13:70738385-70738407 CAGGAAAGTCTGGTGGAGACAGG - Intergenic
1110233525 13:73192253-73192275 CCGGAGAGTGAGAAGGAGGCAGG - Intergenic
1110303080 13:73952146-73952168 CAGAAAAGTTACTTGGAGTCAGG + Intronic
1110517621 13:76434368-76434390 CAGCAAAGTAAGAGAGAGTCTGG - Intergenic
1112203729 13:97303308-97303330 AAGGAAATTCAGGTGGAGTCAGG + Intronic
1112713744 13:102160081-102160103 TAGGAGAGTGAGATGGAGGAAGG - Intronic
1113754322 13:112799405-112799427 CAGCAAAGGGAGATGGAGGTGGG + Intronic
1113969212 13:114176131-114176153 CATGGAAGTGAGCTGCAGTCTGG - Intergenic
1114197852 14:20494873-20494895 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1114221414 14:20701130-20701152 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1114222180 14:20706455-20706477 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1114346068 14:21796544-21796566 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1114744416 14:25132563-25132585 CAGGAAAGTGAATAGGAGGCTGG + Intergenic
1115097065 14:29650012-29650034 CAGGAAAGGGAGCTGGAAGCAGG - Intronic
1115548927 14:34487974-34487996 CAGGAACTTGGCATGGAGTCAGG - Intergenic
1118657097 14:67964259-67964281 AAGGAAAGTGAGTGGGATTCTGG + Intronic
1118980533 14:70712718-70712740 CAGGAAAGTGATTTTAAGTCAGG - Intergenic
1119904970 14:78293454-78293476 TAGGAAGGTGGGATGGAGTAGGG - Intronic
1120312909 14:82854287-82854309 CAAGGAAGTCAGAGGGAGTCTGG - Intergenic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1121099624 14:91241592-91241614 GAGGATAGTAAGATGGAGACAGG - Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1122833837 14:104421407-104421429 GAGGAAAGAGAAATGGAGTGGGG - Intergenic
1122971414 14:105153734-105153756 CAGGAAGATGAGCCGGAGTCTGG - Intronic
1123108891 14:105856094-105856116 CAGGAGAAAGTGATGGAGTCGGG + Intergenic
1123882760 15:24690727-24690749 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1123991133 15:25684153-25684175 CAGGAAAGTGAGATTCAGGGAGG + Intronic
1124373481 15:29116292-29116314 CAGGAAAGTGTGCTGGGGGCTGG - Intronic
1125042685 15:35210015-35210037 CATGAAAGTGTGCTGAAGTCTGG + Intergenic
1126336053 15:47587322-47587344 CAGAAATGTAAGATGGAGCCAGG - Intronic
1126906388 15:53372274-53372296 AAAGAAAGAGAGATGGGGTCGGG - Intergenic
1127844952 15:62861792-62861814 CAGGAAAGAGCGGAGGAGTCAGG - Intergenic
1128809212 15:70557901-70557923 CAAGAAAGAGAGACGGAGACTGG + Intergenic
1129720846 15:77877155-77877177 GAGGAAGGTGAGATGTGGTCAGG + Intergenic
1130788848 15:87130234-87130256 GAGGAAAGGGAGATGGAGGGAGG - Intergenic
1132610630 16:814208-814230 CAGGAGAGTGGGAAGGAGGCCGG + Intergenic
1132781536 16:1629070-1629092 CAGGAACTTGAAATGAAGTCAGG - Intronic
1133937947 16:10284138-10284160 CAGGAAAGTGAGAAGGGGTGGGG - Intergenic
1133937999 16:10284290-10284312 CAGGAAAGTGAGAAGGGATGGGG - Intergenic
1134228744 16:12412937-12412959 CAGGAAAGGGAGAGAGAGCCAGG - Intronic
1135587718 16:23683639-23683661 TAGGAAAGTGAGTTGGTGTTCGG + Intronic
1135909949 16:26551033-26551055 CAGGAAAGTTGGGTGGAGGCTGG + Intergenic
1135931333 16:26740074-26740096 AGGGAAAGTTAGAAGGAGTCAGG + Intergenic
1136083777 16:27870060-27870082 AAGGAAAGAGAGATGGAGAGAGG - Intronic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1140076919 16:71708451-71708473 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1140407607 16:74721486-74721508 CAGGTGAGGGAGATGGAGTAAGG - Intronic
1140712657 16:77692874-77692896 AAGGGAAGTGAGATAGAGGCTGG - Intergenic
1142014501 16:87737549-87737571 CGGGAAGGTGAGCTGGAGTGCGG - Intronic
1142889496 17:2933620-2933642 CAGGAAAGTGAGCAGGGGGCTGG - Intronic
1142951773 17:3487823-3487845 GAGGAAAGTGAAATGGATTTGGG + Intronic
1143866423 17:9926863-9926885 CAGGCAAGTGAGGATGAGTCTGG + Intronic
1144481397 17:15632431-15632453 TAGGAAGGTGAGAGAGAGTCAGG - Intronic
1144612859 17:16739400-16739422 CAAGAAAGTGAAAAGGAGGCTGG - Intronic
1144899926 17:18576187-18576209 CAAGAAAGTGAAAAGGAGGCTGG + Intergenic
1144916904 17:18731291-18731313 TAGGAAGGTGAGAGAGAGTCAGG + Intronic
1145132518 17:20369478-20369500 CAAGAAAGTGAAAAGGAGGCTGG - Intergenic
1145741912 17:27281836-27281858 CAGGGAAGAAAGATGAAGTCAGG + Intergenic
1146644005 17:34564370-34564392 CAGGAAAATGAGGAAGAGTCAGG - Intergenic
1147510075 17:41060397-41060419 GAGGAAAGTGTGATGGTGGCTGG - Intergenic
1148246558 17:46034940-46034962 CAGGAATGTGAGGTATAGTCAGG - Intronic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1149320496 17:55476396-55476418 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1149395863 17:56243236-56243258 AAGGAGAGTGAGATGGAGGGAGG - Intronic
1150838732 17:68588378-68588400 CAGGGAACTGAGATGGAGACAGG + Intronic
1151051805 17:70986454-70986476 CAGGAATGTCAGATGCCGTCAGG - Intergenic
1151756682 17:76079281-76079303 CAGGAAGGTGAGATGGAGCAGGG - Exonic
1151790948 17:76305524-76305546 AAGGGAAGTGAGATGCAGTGGGG + Intronic
1151848984 17:76678550-76678572 CAGAAGAGTGAGATGCAGCCAGG - Intronic
1152224830 17:79087869-79087891 CAGGCAAGGAAGATGGAGACAGG - Intronic
1152834905 17:82523146-82523168 AAGGGCAGTGAGATGGAGGCTGG + Intronic
1155044305 18:22090130-22090152 CAGCAAATTGAGAGGGAGCCAGG + Intronic
1155064269 18:22255114-22255136 AAGGAAAGGGAGAGGCAGTCTGG - Intergenic
1155591797 18:27435910-27435932 CAGGAAAGTGTTGTGGAATCTGG - Intergenic
1156939191 18:42744179-42744201 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1157026145 18:43846304-43846326 CAGGATGTTGTGATGGAGTCTGG - Intergenic
1157332554 18:46714316-46714338 AAGAAAAGGGAGTTGGAGTCGGG - Intronic
1158522761 18:58185222-58185244 CAGGGAAGTGAGCTACAGTCTGG - Intronic
1158907112 18:62024427-62024449 CAGCCAAGTGAGATGTGGTCTGG - Intergenic
1159164964 18:64687200-64687222 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1159582005 18:70243681-70243703 CAGGAAAATGTAATGGAATCTGG + Intergenic
1160041068 18:75346108-75346130 TGGGAAACTGAGATGGAGACGGG + Intergenic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1161659664 19:5538154-5538176 CAGGACAGGGAGGTGGAGGCAGG + Intergenic
1161818748 19:6516369-6516391 CAGGAAAGTGGGAAGGACTGAGG + Intergenic
1161827355 19:6577174-6577196 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1162038971 19:7957987-7958009 CAGGAAAATGAGATCAAGTAGGG - Intergenic
1162922040 19:13908914-13908936 AAAGAAAGAGAGATGGAGCCGGG - Intronic
1164184704 19:22854407-22854429 CAGGAAAGTAAGTTGGATTTTGG + Intergenic
1164856565 19:31529315-31529337 CAGGAATGTGGGATGGGGCCTGG - Intergenic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1166316542 19:41992907-41992929 CAGGTAAGTGGGATGGAGGGAGG - Intronic
1166764392 19:45244365-45244387 GGGGAAAGTCAGATGTAGTCCGG - Intronic
1167935718 19:52905382-52905404 CAGGGAAGGGAGATGGGGTGGGG - Intergenic
1168723642 19:58569257-58569279 CAGGTAAGTGAGATGGGGTGTGG - Exonic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
926246093 2:11123342-11123364 CAAGGAAATGAGCTGGAGTCGGG + Intergenic
926372047 2:12188577-12188599 CAGGTATGTGACATGGTGTCAGG + Intergenic
928301507 2:30129558-30129580 CAGGAAGTAGAGATGGAGTGTGG + Intergenic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928985863 2:37181057-37181079 CATGAAAGTGGGAGGGAATCAGG + Intronic
929004347 2:37381116-37381138 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
930954670 2:57192608-57192630 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
930954784 2:57193371-57193393 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
932034925 2:68234628-68234650 CACGACAGTGAGAGGGTGTCAGG + Intronic
932114080 2:69029586-69029608 AAGGAAAGTGAGATTCAGACTGG + Intronic
933912239 2:86951850-86951872 CAGGAAATTAAGAGGGAGGCAGG + Intronic
934010755 2:87818047-87818069 CAGGAAATTAAGAGGGAGGCAGG - Intronic
934747628 2:96769965-96769987 AGGGAAAGTGAGAAGGAGCCTGG - Intronic
935774323 2:106458748-106458770 CAGGAAATTAAGAGGGAGGCAGG - Intronic
935905745 2:107837165-107837187 CAGGAAATTAAGAGGGAGGCAGG + Intronic
935957279 2:108389828-108389850 CAGGAAAGTAAGAGGTAGGCTGG - Intergenic
935992225 2:108729694-108729716 CAGGAAATTAAGAGGGAGTCAGG + Intronic
936127542 2:109802346-109802368 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936217155 2:110569139-110569161 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936426295 2:112423722-112423744 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936794662 2:116190643-116190665 CAGGGAAGGGAGATGGGGTGGGG + Intergenic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
937484306 2:122298002-122298024 TGGGAAAGTGATATGGGGTCGGG + Intergenic
937485511 2:122310924-122310946 GAGGAAACTGAGATGGAGAGGGG - Intergenic
937485880 2:122314402-122314424 GAGGAAACTGAGATGGAGAGGGG + Intergenic
937956126 2:127422695-127422717 CAGGGACGTGGGATGGAGGCTGG + Intronic
938096145 2:128465471-128465493 AGGGAAAGTGAGAGGGAGGCTGG - Intergenic
938339476 2:130526126-130526148 CACGGAAGTGAGATGGGGCCCGG + Intronic
938350363 2:130594626-130594648 CACGGAAGTGAGATGGGGCCCGG - Intronic
939028709 2:137044860-137044882 CAGAATAGTGACATGGATTCAGG - Intronic
939461003 2:142495039-142495061 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
939788006 2:146540170-146540192 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
940037470 2:149325894-149325916 GAGGAAAGAGAGATGGAGAATGG + Intergenic
940395741 2:153189163-153189185 CAAGAAAGTGAGAATGAGCCTGG - Intergenic
940508203 2:154582740-154582762 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
942695407 2:178636966-178636988 CAGGAAAATGAGATGGTATAAGG + Intronic
942763478 2:179427463-179427485 CAGGGAAGTGGGCTGGAGACAGG + Intergenic
942867762 2:180696944-180696966 GGGGAGAGTCAGATGGAGTCGGG + Intergenic
943328995 2:186536476-186536498 CAGAAAAATGAGATGGTGACTGG + Intergenic
944033743 2:195268299-195268321 CAGGAAAGTGACAGGGAGAATGG - Intergenic
944507281 2:200425524-200425546 GAGGAAAGTGAGATGCAGAGTGG - Intronic
946039839 2:216774014-216774036 CATGAAGGTGAGAAGGAGTTGGG + Intergenic
946078825 2:217098748-217098770 GACGAAAGTGAGATCGAATCAGG - Intergenic
947215543 2:227746370-227746392 CAGAAAAGTGCCATGAAGTCTGG - Intergenic
948409304 2:237746932-237746954 CAGGCCAGTGGGATGCAGTCAGG - Intronic
1168839661 20:901475-901497 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1169043739 20:2518952-2518974 CAGGAAAGAGAGAGGGGGGCAGG - Intronic
1169391223 20:5192868-5192890 CAGGATAGTGTGGTGGAGTCAGG + Exonic
1169737131 20:8849318-8849340 AAGGAAACTGAGATGCAGACTGG + Intronic
1169925722 20:10782013-10782035 CAGGAAAGTGAGATAGGGAAGGG + Intergenic
1170504241 20:17008374-17008396 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1170509451 20:17061387-17061409 CAGGTAAGTGAGGTGGAAGCAGG - Intergenic
1171265090 20:23765052-23765074 CAGCAAAGAGAGATGGGGTGGGG - Intergenic
1172224628 20:33297215-33297237 CATGAGAGTGAAATGGAGGCTGG - Intronic
1172785593 20:37466314-37466336 CAGGAAAGGGAGAGGAGGTCCGG - Intergenic
1173362269 20:42355323-42355345 CAGTAAAGAGATATGGAGTGGGG - Intronic
1173571391 20:44078961-44078983 CTGGAAGGGGAGATGCAGTCTGG - Intergenic
1173607549 20:44342428-44342450 AGGGAAAGTGAAATGGAGGCAGG - Intronic
1173644449 20:44624893-44624915 GAGGAAACTGAGGTGGAGTGAGG - Intronic
1175294348 20:57898019-57898041 CAGGTAAGGGAGATGGAGCCTGG - Intergenic
1175600294 20:60267342-60267364 GTGGAAAGTGAGATGGAGCAGGG + Intergenic
1177136536 21:17310171-17310193 CATGAAAGTGACATGGAGAATGG + Intergenic
1177416931 21:20806181-20806203 CAGAAAGGTGAAATGGAGTCAGG - Intergenic
1177825764 21:26081314-26081336 CAGGAAAGGGAGATGGGGTAGGG + Intronic
1177908594 21:27001671-27001693 CAGCTAAGTGAGATGAACTCAGG + Intergenic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1180569204 22:16699907-16699929 GAGGAAAGTGAGATGGAACGCGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181787531 22:25237811-25237833 CTGGGAAGTGGGCTGGAGTCTGG + Intergenic
1182999089 22:34839901-34839923 CAGTGAAGTGAGATGGGGTGGGG - Intergenic
1183255404 22:36758569-36758591 AAGGAAACTCAGATGGAGTCAGG + Intronic
1183535049 22:38396640-38396662 CAGCAAAGGGAGATGGGGTGGGG + Intronic
1183573134 22:38669254-38669276 CAGGAAGGAGAGCTGGAGTGAGG - Intronic
1183696572 22:39427004-39427026 CTTGAAACGGAGATGGAGTCAGG + Intronic
1183750784 22:39719245-39719267 TAGGGAAGAGAGATGGAGTTGGG - Intergenic
1183863298 22:40684727-40684749 CTGGAAGGTGAGAGGGAGTGAGG - Intergenic
1184095376 22:42313494-42313516 CAGGAAAGTGAGTTGCATTCTGG - Intronic
1184300264 22:43554591-43554613 CAGGGAAGGGAGAAGGAGTGTGG + Intronic
1184467167 22:44675605-44675627 CAGGAAACTGAGATGCAGGGAGG - Intronic
1185047173 22:48534360-48534382 CAGGCAGGTGAGATGGGGCCGGG + Intronic
949399267 3:3648592-3648614 AAGGTAAGTGAGAGGGTGTCTGG - Intergenic
949494400 3:4618263-4618285 CTGGAAAGTGAGAAGGCGTGAGG - Intronic
949592471 3:5508821-5508843 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
950478909 3:13232616-13232638 CACGAAAGTGAGCTGGAGTCAGG + Intergenic
950510493 3:13423064-13423086 TAGGCAAGTGAAATGGGGTCTGG - Intergenic
951303546 3:21028489-21028511 CAGCAAAGTGAGATGGAGTCTGG + Intergenic
951846307 3:27088381-27088403 AAGGAAAATGATATGGAGGCTGG + Intergenic
952006366 3:28846841-28846863 CAGGAAAGGGAGGTGAAGTAGGG - Intergenic
953200485 3:40773984-40774006 CAGGTAAGTGAGATTGAGAAGGG + Intergenic
953335364 3:42089706-42089728 CAGGAAAGGGAGATGGGGAAAGG - Intronic
953683196 3:45055676-45055698 AAGGCAAGTGAGATGAAGGCTGG + Intergenic
953885081 3:46710453-46710475 CCGGAAAGAGAGCTGGAGTCTGG + Exonic
954950513 3:54468592-54468614 CTGGAAAGTGGGCTGAAGTCAGG + Intronic
955396618 3:58562295-58562317 CAGCAAAGGGAGATGGGGTGAGG - Intergenic
955685201 3:61542413-61542435 CTTGAAATTGAGAGGGAGTCAGG - Intergenic
956376262 3:68616484-68616506 AAGGAAAGTGAGATCAAGTCAGG - Intergenic
957050779 3:75410268-75410290 CTGGCAAGTGAGATGGATGCTGG + Intergenic
957893269 3:86387164-86387186 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
958884107 3:99707077-99707099 CAGAAAAGTGAAATGCAGTATGG + Intronic
959766099 3:110030685-110030707 AAGGAATGTAAGATGTAGTCTGG + Intergenic
959800979 3:110495181-110495203 CTGGAAAGGGAGATGAAGTCAGG + Intergenic
960942029 3:122941183-122941205 AAGGAAAATGAGCTGGAGACAGG + Intronic
961867425 3:129963896-129963918 CAGGAAAGAGAGATTGAGACGGG - Intergenic
961917598 3:130393294-130393316 CAGAAAAGTGAGACGTAGGCAGG - Intronic
962243637 3:133772822-133772844 CAGGAATGTGATATTAAGTCAGG - Intronic
962660347 3:137595925-137595947 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963794239 3:149615772-149615794 AAGGCAAGTGAGATGGAGGAGGG + Intronic
964431391 3:156610315-156610337 CAGGAAAGGCAGAAAGAGTCTGG + Intergenic
964742290 3:159979230-159979252 TAGGAAAGTGAAATTGAGTTGGG + Intergenic
964984121 3:162718136-162718158 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
966274083 3:178143347-178143369 AAGGAATGTGAGAAGGGGTCTGG - Intergenic
967290176 3:187911895-187911917 CAGTAAATTGAAATGGAGGCAGG + Intergenic
967495912 3:190144886-190144908 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
968491001 4:890448-890470 CAGCACATTGGGATGGAGTCTGG - Intronic
968653697 4:1769831-1769853 CAGGGAAGTCAGGTGGAGTAAGG + Intergenic
968730790 4:2268377-2268399 CAGGAGAGTGCCATGGGGTCTGG - Intergenic
968993074 4:3927732-3927754 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
969209215 4:5673570-5673592 AAGGAAAGTGAGGAGGACTCTGG - Intronic
969226563 4:5802340-5802362 TAGGATACTGAGATGGAGTCAGG + Intronic
969355216 4:6621069-6621091 CAGGAGGGTGAGAGGGAGGCTGG + Intronic
969608255 4:8212853-8212875 CAGGGATGGGAGCTGGAGTCAGG + Intronic
970133850 4:12900412-12900434 CAGGAAAGTAAAACTGAGTCTGG - Intergenic
970853525 4:20629870-20629892 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
970937913 4:21596551-21596573 CAGGAAAGGTAGATGGAGATAGG - Intronic
971394164 4:26213418-26213440 TAGGAAAATGAGAAGGGGTCAGG + Intronic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
974473327 4:62347083-62347105 CATGTAAGTTAGATGGAGCCAGG + Intergenic
974849067 4:67384095-67384117 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
975424304 4:74208641-74208663 CAGTAAAGTGAGAAGGATTCCGG + Intronic
976087494 4:81421122-81421144 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
976210941 4:82669095-82669117 CAGTCAAGGGAGATGGAGTCAGG + Intronic
976271579 4:83235713-83235735 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
976558299 4:86475102-86475124 CAGTGAAGAGAGATGGAGTGGGG - Intronic
977041674 4:92026117-92026139 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
978103028 4:104866626-104866648 CAGGCAAGTGATATTGTGTCAGG - Intergenic
978588627 4:110300253-110300275 CGGGAAAGTGGACTGGAGTCTGG + Intergenic
978991152 4:115084049-115084071 CAGGAAAGTAAGATAAAGTTTGG + Intronic
979032267 4:115665231-115665253 CAGGAAAGTGACATGTAGCCTGG - Intergenic
979965998 4:127077317-127077339 CAGGAAAGGGGGCTGGAGCCAGG - Intergenic
980285437 4:130773147-130773169 CAGGGAAGGGAGATGGGGTGGGG - Intergenic
980575961 4:134683247-134683269 CAGGGAAGGGAGATGGGGTGGGG + Intergenic
980593130 4:134917333-134917355 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
980829521 4:138113026-138113048 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
981089430 4:140717288-140717310 CAGGAAAGAGAGAGGGAGAGGGG + Intronic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
982171359 4:152664907-152664929 CAGGAGAATGAAAAGGAGTCAGG - Intronic
982318532 4:154056830-154056852 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
983359326 4:166708761-166708783 GAGCAAAGTGAGATGGGGTGGGG + Intergenic
983408989 4:167372544-167372566 TAGGAAAGTGAGATATAGACAGG - Intergenic
985183071 4:187286585-187286607 CATGAAAATGAGATGGAATTTGG + Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
987043796 5:14087449-14087471 CAGGAATGTGAGATGAAGAGGGG + Intergenic
987356705 5:17069677-17069699 GAGGAAAATAAGATGGATTCAGG + Intronic
987705220 5:21454886-21454908 CAGTGAAGGGAGATGCAGTCAGG + Intergenic
988055972 5:26097244-26097266 CAGAAAAGTTTGCTGGAGTCTGG - Intergenic
988300706 5:29422311-29422333 CAGTGAAGGGAGATGCAGTCAGG - Intergenic
988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG + Intergenic
989405800 5:41059115-41059137 CAGGAAAGAGAAACAGAGTCAGG - Intronic
989615407 5:43333093-43333115 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
990557883 5:56952724-56952746 CAGGAATGGGAGATGGAGACCGG + Intronic
991458682 5:66833423-66833445 CAGGGCAGTGATATGGACTCTGG - Intronic
991480678 5:67076007-67076029 CAGTAGAGTGGGATGGTGTCAGG - Intronic
992200092 5:74374694-74374716 AAAGAAAGTGAGATGGCCTCTGG + Intergenic
993487122 5:88500628-88500650 CAGCCAAGTGTGATGGAGTTTGG + Intergenic
993728785 5:91398178-91398200 AAGTAAAGAGAGATGGAATCTGG + Intergenic
994324561 5:98434829-98434851 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
994765953 5:103918930-103918952 CAGGACAGTCAGTTGGAGTGAGG + Intergenic
995414070 5:111889791-111889813 CAGCAAAGGGAGATGGGGTGGGG + Intronic
995471100 5:112503083-112503105 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
996030597 5:118700108-118700130 AAGGAGAGAGAGATGGAGTTAGG - Intergenic
997183456 5:131857703-131857725 CAGCAAAGTGAGGTGGAGGAAGG - Intronic
997384751 5:133463871-133463893 CAGCAAAGTTAGGTGGAGGCTGG + Intronic
997497848 5:134345565-134345587 CAGCAAAGGGAGATGGGGTGGGG + Intronic
998506359 5:142675396-142675418 CAGCACAGAGAGATGGATTCTGG - Intronic
998715049 5:144873627-144873649 CATGTAAATGATATGGAGTCTGG - Intergenic
998874534 5:146586135-146586157 CTTGGAAGTGAAATGGAGTCAGG - Intronic
999313704 5:150570317-150570339 CATGCAAGTGAGCAGGAGTCTGG - Intergenic
999593209 5:153171912-153171934 CAGGGAACTGAAATGGAGCCTGG + Intergenic
1000548047 5:162625872-162625894 CAGGAAAGGGGGCTGAAGTCAGG + Intergenic
1000759178 5:165200665-165200687 CAAGAAAGTGAGGTAGACTCAGG - Intergenic
1000884953 5:166740154-166740176 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1001180584 5:169516344-169516366 CAGAATAGTAAGATGGGGTCAGG + Intergenic
1001233575 5:170010457-170010479 CAGGAAGATGAGAAGGAGTAAGG + Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1003252965 6:4448134-4448156 CAGGAAAGGGAGACGGCATCTGG - Intergenic
1003892495 6:10575931-10575953 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1004029569 6:11853088-11853110 CAGCAAAGAGACTTGGAGTCAGG + Intergenic
1004175026 6:13332233-13332255 AAGGAAATGGAGATGGAGTGAGG + Intergenic
1004176893 6:13347919-13347941 AAGGAAAGTGAAGAGGAGTCAGG + Intergenic
1005284643 6:24312200-24312222 CAGCAAAGGGAGATGGGGTGAGG - Intronic
1005785853 6:29245578-29245600 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1005890762 6:30135977-30135999 CTGGAAGGTGAGATGGACTTTGG - Intergenic
1006603279 6:35239573-35239595 CAGGAAAGAGAGAGAGAGACAGG + Intronic
1006722825 6:36170070-36170092 CTAGAATGGGAGATGGAGTCAGG + Intergenic
1007637280 6:43307060-43307082 GAGGAAAGTGAGATCCAGACAGG - Intronic
1007713317 6:43838527-43838549 CAGGAAAGTGACCTGGGGCCAGG - Intergenic
1007730523 6:43942716-43942738 CCAGCAAGTGAGATGGAGCCAGG + Intergenic
1008042527 6:46816881-46816903 CAGGAAGGTGAGCAGGAGCCTGG + Intronic
1008456391 6:51715902-51715924 AAGGAAATTCAAATGGAGTCCGG + Intronic
1009023083 6:57966020-57966042 CAGTGAAGGGAGATGCAGTCAGG - Intergenic
1011131206 6:84053313-84053335 AAGGAAAATAAGATGAAGTCTGG - Intronic
1012547910 6:100440565-100440587 GGAGAAAGGGAGATGGAGTCAGG + Intronic
1012986963 6:105885452-105885474 CTGTAAAGTGAGTTAGAGTCAGG + Intergenic
1013235317 6:108193488-108193510 CAGGAAACTGAGCAAGAGTCAGG + Intergenic
1013655413 6:112241793-112241815 CAGGAAAGTGCTTTTGAGTCAGG - Intronic
1014568008 6:122974818-122974840 CAGGGATGTGAGATGGAGGGAGG + Intergenic
1014897942 6:126926759-126926781 CAGGAAATTGAGAAGCGGTCGGG - Intergenic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1016107273 6:140178263-140178285 CTTGAAAGTGAGCTGGAGGCCGG - Intergenic
1017174092 6:151485630-151485652 CAGGAAAGTAAGATAGAGAGAGG - Intergenic
1017918037 6:158847741-158847763 CAAGAAAATGAGATGGGGCCAGG - Intergenic
1018216598 6:161534117-161534139 CAGGACAGGGAAAGGGAGTCTGG - Intronic
1018495803 6:164344470-164344492 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1019434525 7:1015215-1015237 GAGGAAAGAGAGGTGGGGTCGGG + Intronic
1020317095 7:6913432-6913454 CTGGCAAGTGAGATGGATGCTGG + Intergenic
1020317853 7:6919295-6919317 CTGGCAAGTGAGATGGATGCTGG - Intergenic
1020484307 7:8702836-8702858 CAGAAAAGTTTCATGGAGTCAGG - Intronic
1020777596 7:12474026-12474048 CAAGGAAAAGAGATGGAGTCAGG + Intergenic
1021100914 7:16585435-16585457 CAGGAAGGTGAGATTGGGGCAGG + Intergenic
1022708787 7:32832894-32832916 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1023100334 7:36711520-36711542 CAGGAAAGAGAGAGGCAGACAGG + Intronic
1023683871 7:42715637-42715659 CAGGAACCTGAGATGTGGTCTGG - Intergenic
1024201618 7:47114401-47114423 AAGGAAGGTGAGCTGGAGTTAGG - Intergenic
1024374046 7:48618090-48618112 CAGGAAGGTGGGATGAACTCAGG - Intronic
1024511936 7:50211647-50211669 CAGGAAAGAGGGATGGCCTCAGG + Intergenic
1024670125 7:51586557-51586579 CAGCAAACTTAGAGGGAGTCAGG - Intergenic
1024946660 7:54814699-54814721 GAGAAAAGTGAATTGGAGTCAGG + Intergenic
1024950530 7:54856003-54856025 CTGGAAAGTGAGCTGAAGCCAGG - Intergenic
1025919951 7:65902152-65902174 CAGGAAAATGTGATGTAATCAGG + Intronic
1026286326 7:68966305-68966327 GAGGAAAGTGGGATGGAGAAAGG + Intergenic
1026331015 7:69352552-69352574 CTGGAAAGTGAATTGGAGTTGGG + Intergenic
1026794710 7:73359065-73359087 CAGGAGGGTGAGATGGCCTCAGG - Intergenic
1027230580 7:76269434-76269456 CAGAAAAGTGAGATGGGGGATGG + Intronic
1027775082 7:82454914-82454936 CAGGAAAATGAGACAGAGGCTGG + Intergenic
1028867273 7:95728124-95728146 CAGGAAGGTGAGATAGAAGCTGG + Intergenic
1031686307 7:124734612-124734634 CAGCAAAGAGAGATGGGGTGGGG - Intergenic
1031776995 7:125917844-125917866 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1031973442 7:128079473-128079495 CTGGAAGGTGAGAAGGGGTCAGG + Intronic
1032389399 7:131546236-131546258 AAGGAAAGTGAAAGGGAGACTGG + Intronic
1033460124 7:141539335-141539357 GAGGAAGGTGAGAAGGAGTTAGG + Intergenic
1033657415 7:143382763-143382785 GAGGGAAGAGAGATGCAGTCAGG - Intronic
1034017352 7:147601300-147601322 CAGCAAAGGGAGATGGGGTGGGG + Intronic
1034084249 7:148309517-148309539 CAGCAAAGGGAGATGGGGTGGGG + Intronic
1034345061 7:150380951-150380973 AAGCAAAGTGAGATGGAGCAGGG - Intronic
1035051804 7:156003234-156003256 GAGGAAAGAGAGCTGAAGTCTGG - Intergenic
1035366987 7:158355434-158355456 CAGGAGAGTGAGAGAGAGGCAGG - Intronic
1035983689 8:4401983-4402005 CAGGAATGTGGCAGGGAGTCCGG - Intronic
1036589294 8:10153367-10153389 CAGGCACGTGAGAGGGAGACAGG - Intronic
1036595826 8:10211176-10211198 CAGGAAAGACAGATAGAGTGTGG + Intronic
1037310498 8:17550514-17550536 CAGGAAAGAGAGAGGGATTTCGG + Intronic
1037451982 8:19024698-19024720 CAGGAAGGGGAGAGGGGGTCTGG + Intronic
1037814215 8:22103329-22103351 CAGGCCAGTGAGATGGGGCCTGG + Exonic
1037962806 8:23111645-23111667 AGGGAATGTGAGATGGAGCCTGG + Intronic
1038285340 8:26201388-26201410 CAGGAAGGGGAGATGGATACAGG - Intergenic
1038936468 8:32257261-32257283 CTGGAAAGGGGGCTGGAGTCAGG - Intronic
1039669460 8:39580326-39580348 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1039688134 8:39830589-39830611 GTGGAAAGTAAGATGGATTCTGG + Intronic
1039901793 8:41758016-41758038 CAGGTAAGTGGGATGGAGGCAGG - Exonic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041311519 8:56522388-56522410 CAGGAAAGTTAGATGCAGAAAGG + Intergenic
1042048056 8:64676536-64676558 CAGGACAGTGACATTGGGTCTGG + Intronic
1042346831 8:67736146-67736168 CAGGAAAGTGAGATGGAGTCAGG - Intronic
1042576003 8:70219484-70219506 GGGGAAAGTGGGGTGGAGTCGGG + Intronic
1043596910 8:81898119-81898141 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1043717377 8:83504804-83504826 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1043766808 8:84145665-84145687 TCTGAAAGTGAGATGGAGTATGG + Intergenic
1044654001 8:94528824-94528846 CAGAAAACTGAGATACAGTCAGG + Intronic
1045152072 8:99419212-99419234 CAGGAAAGAGATAGGGAGTGAGG - Intronic
1045360865 8:101432106-101432128 CAGGGAACTGTGATGCAGTCTGG + Intergenic
1045974193 8:108112890-108112912 CAGCAAAGTGAAATGGAATTTGG + Intergenic
1046550544 8:115710248-115710270 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1046594886 8:116249578-116249600 CAGAAAAGGGAGATTGAGTTAGG - Intergenic
1046715292 8:117560342-117560364 CAAGAAAATGGGGTGGAGTCAGG - Intergenic
1047930249 8:129721323-129721345 CAGGAAAATGATTTGGAGTAAGG - Intergenic
1049761758 8:144334814-144334836 CAGGATGGTGAGAGGGAGTTCGG - Intronic
1050343689 9:4665503-4665525 CAGGAAATTGTCATGGAATCTGG - Intronic
1050345351 9:4680167-4680189 CAGGAAGGGGAGATGGAGGAAGG - Intronic
1050437466 9:5626108-5626130 CTGGACAGTGAGAGGGAGTGGGG - Intergenic
1051614229 9:18992142-18992164 CAGGAAAGTGATATGTAGTGGGG - Intronic
1051695657 9:19765904-19765926 CCGGAAAGTGACATGGAGATTGG - Intronic
1051952919 9:22658627-22658649 CAGGGAAGGGAGATGGGGTGGGG + Intergenic
1052021749 9:23533007-23533029 CAGTGAAGTCAGATGGAGCCAGG - Intergenic
1052503893 9:29328234-29328256 CATGAGAGGAAGATGGAGTCTGG - Intergenic
1052520472 9:29541536-29541558 AAGGACAGAGAGATGGAGGCAGG - Intergenic
1053108445 9:35435272-35435294 CAGGAAAGAGAGAGAGAGTGAGG + Intergenic
1053461908 9:38277946-38277968 CAGCAAGTTGAGATGGAGCCCGG - Intergenic
1055586880 9:77764137-77764159 CAAGAAAGTGAGATTGAGTCAGG + Intronic
1056195552 9:84225101-84225123 CAAGAAATTGAGATGGAGCAGGG - Intergenic
1056221421 9:84453759-84453781 CAGGAAAGGGAGACTGAGACAGG - Intergenic
1056263897 9:84877092-84877114 AAGGAAAGTGTGATTGATTCAGG - Intronic
1056363174 9:85879331-85879353 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1057404721 9:94758518-94758540 CAGGGAAGTGAGGAGGAGTTAGG + Intronic
1057419819 9:94902325-94902347 CAGCAAACTGAGCTGGAGTGGGG + Intronic
1057480301 9:95440129-95440151 CAGGAAAGTGGGATGCACTGTGG + Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058307294 9:103459849-103459871 GAGGAAAGGGGGCTGGAGTCAGG - Intergenic
1058668843 9:107343715-107343737 CAGCAGAGTGATATGGATTCTGG + Intergenic
1058799679 9:108533140-108533162 CAGGAAAGAGATATGGACTCTGG + Intergenic
1059050333 9:110917796-110917818 TAAGAAAATGACATGGAGTCAGG - Intronic
1059321841 9:113476255-113476277 CAGGAAAGAGTGCTGGAGTGGGG + Intronic
1060343636 9:122798272-122798294 CAGGAAAGTGAGAAAGAATTAGG + Intergenic
1060919937 9:127413539-127413561 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1061385566 9:130287375-130287397 TAGGAAGGTGAGAAGGAGCCAGG - Intronic
1062632630 9:137472288-137472310 AAAGAAAATGAGATGGAGGCTGG + Intronic
1062670785 9:137707742-137707764 GAGGACTGTGAGATGGAGTGGGG + Intronic
1185636883 X:1559348-1559370 CCAGATAGTGAGATGGTGTCTGG + Intergenic
1185960207 X:4540577-4540599 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1186898762 X:14031525-14031547 CAGGAAAGAAAGATGGAGAGGGG + Intergenic
1188438836 X:30194146-30194168 CAGGAAAGGGAGATGGGGTGGGG - Intergenic
1188460118 X:30415833-30415855 TAGGAAAGTGAGACGGAGATAGG - Intergenic
1188867900 X:35337071-35337093 GAGGAATGGTAGATGGAGTCTGG + Intergenic
1189373974 X:40451977-40451999 CAGGAAAGAGAGGTGGGGTGGGG + Intergenic
1189714071 X:43846635-43846657 TAGGAAACTGAGTTGGAGTCTGG + Intronic
1189852294 X:45189665-45189687 CATGAAAGTGAGAAAGAGTGTGG + Intronic
1190198591 X:48341372-48341394 AAGGAAAGTGAAATGGAGACAGG - Intergenic
1190665360 X:52691783-52691805 AAGGAAAGTGAAATGGAGACAGG - Intronic
1190674062 X:52766636-52766658 AAGGAAAGTGAAATGGAGACAGG + Intronic
1190739927 X:53281851-53281873 CAGAAAATTGAGATGGAGAGAGG + Intronic
1192370350 X:70507755-70507777 GAGCAAAGTGAGATGCAGCCTGG - Intergenic
1192705804 X:73528000-73528022 CAGGGAAGGGAGATGGGGTGGGG - Intergenic
1193086294 X:77449917-77449939 CAGGAAAGTGACAGGAAGTCAGG - Intronic
1193607676 X:83588563-83588585 CAGCAGAATGAGATGGAGTTTGG - Intergenic
1194200979 X:90952516-90952538 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1194696788 X:97062515-97062537 AAGGACAGGGAGATGGTGTCAGG + Intronic
1194804557 X:98311510-98311532 AAGGAAAGGTAAATGGAGTCTGG - Intergenic
1194936152 X:99951517-99951539 AAGGAAAGAGAGAGGGAGTAAGG - Intergenic
1196569010 X:117243985-117244007 CATTAAAGTGAGATGGAATTTGG + Intergenic
1198044371 X:132886041-132886063 CAGAAAAGTGAGATGTGCTCAGG + Intronic
1198811287 X:140538807-140538829 CAGGAAGATGACTTGGAGTCTGG + Intergenic
1198964259 X:142210679-142210701 CAGGAGAATGAGGTGGAGTTTGG + Intergenic
1199478425 X:148272015-148272037 CAGGAAGTTGAGATGAAATCTGG - Intergenic
1199992888 X:152999012-152999034 GAGGAAAGTGAGATGGAGCAGGG + Intergenic
1200065460 X:153502392-153502414 CAGGAGAGCAAGATGGAGTGGGG - Intronic
1200798632 Y:7364392-7364414 CAGCAAAGTGCGATGGTGACAGG - Intergenic
1201362191 Y:13164595-13164617 CAGCAAAGGGAGATGGGGTAGGG + Intergenic