ID: 1042351057

View in Genome Browser
Species Human (GRCh38)
Location 8:67778113-67778135
Sequence CCTATTGGATGGTGTGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042351057_1042351064 16 Left 1042351057 8:67778113-67778135 CCAGCATCACACCATCCAATAGG No data
Right 1042351064 8:67778152-67778174 TAAACAATAGGACGCATTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 103
1042351057_1042351066 25 Left 1042351057 8:67778113-67778135 CCAGCATCACACCATCCAATAGG No data
Right 1042351066 8:67778161-67778183 GGACGCATTTCTGGCACTAAGGG No data
1042351057_1042351063 4 Left 1042351057 8:67778113-67778135 CCAGCATCACACCATCCAATAGG No data
Right 1042351063 8:67778140-67778162 CAAGGTCAGGCATAAACAATAGG No data
1042351057_1042351061 -9 Left 1042351057 8:67778113-67778135 CCAGCATCACACCATCCAATAGG No data
Right 1042351061 8:67778127-67778149 TCCAATAGGTATGCAAGGTCAGG No data
1042351057_1042351065 24 Left 1042351057 8:67778113-67778135 CCAGCATCACACCATCCAATAGG No data
Right 1042351065 8:67778160-67778182 AGGACGCATTTCTGGCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042351057 Original CRISPR CCTATTGGATGGTGTGATGC TGG (reversed) Intergenic