ID: 1042351062

View in Genome Browser
Species Human (GRCh38)
Location 8:67778128-67778150
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042351062_1042351066 10 Left 1042351062 8:67778128-67778150 CCAATAGGTATGCAAGGTCAGGC No data
Right 1042351066 8:67778161-67778183 GGACGCATTTCTGGCACTAAGGG No data
1042351062_1042351064 1 Left 1042351062 8:67778128-67778150 CCAATAGGTATGCAAGGTCAGGC No data
Right 1042351064 8:67778152-67778174 TAAACAATAGGACGCATTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 103
1042351062_1042351065 9 Left 1042351062 8:67778128-67778150 CCAATAGGTATGCAAGGTCAGGC No data
Right 1042351065 8:67778160-67778182 AGGACGCATTTCTGGCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042351062 Original CRISPR GCCTGACCTTGCATACCTAT TGG (reversed) Intergenic