ID: 1042351065 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:67778160-67778182 |
Sequence | AGGACGCATTTCTGGCACTA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1042351062_1042351065 | 9 | Left | 1042351062 | 8:67778128-67778150 | CCAATAGGTATGCAAGGTCAGGC | No data | ||
Right | 1042351065 | 8:67778160-67778182 | AGGACGCATTTCTGGCACTAAGG | No data | ||||
1042351057_1042351065 | 24 | Left | 1042351057 | 8:67778113-67778135 | CCAGCATCACACCATCCAATAGG | No data | ||
Right | 1042351065 | 8:67778160-67778182 | AGGACGCATTTCTGGCACTAAGG | No data | ||||
1042351060_1042351065 | 13 | Left | 1042351060 | 8:67778124-67778146 | CCATCCAATAGGTATGCAAGGTC | No data | ||
Right | 1042351065 | 8:67778160-67778182 | AGGACGCATTTCTGGCACTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1042351065 | Original CRISPR | AGGACGCATTTCTGGCACTA AGG | Intergenic | ||