ID: 1042351065

View in Genome Browser
Species Human (GRCh38)
Location 8:67778160-67778182
Sequence AGGACGCATTTCTGGCACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042351062_1042351065 9 Left 1042351062 8:67778128-67778150 CCAATAGGTATGCAAGGTCAGGC No data
Right 1042351065 8:67778160-67778182 AGGACGCATTTCTGGCACTAAGG No data
1042351057_1042351065 24 Left 1042351057 8:67778113-67778135 CCAGCATCACACCATCCAATAGG No data
Right 1042351065 8:67778160-67778182 AGGACGCATTTCTGGCACTAAGG No data
1042351060_1042351065 13 Left 1042351060 8:67778124-67778146 CCATCCAATAGGTATGCAAGGTC No data
Right 1042351065 8:67778160-67778182 AGGACGCATTTCTGGCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042351065 Original CRISPR AGGACGCATTTCTGGCACTA AGG Intergenic