ID: 1042352731

View in Genome Browser
Species Human (GRCh38)
Location 8:67794161-67794183
Sequence TTGAATGACCTTGAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042352725_1042352731 -2 Left 1042352725 8:67794140-67794162 CCGGGACAGATGGCTTGACCCTT No data
Right 1042352731 8:67794161-67794183 TTGAATGACCTTGAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042352731 Original CRISPR TTGAATGACCTTGAGGAGGT GGG Intergenic
No off target data available for this crispr