ID: 1042356576

View in Genome Browser
Species Human (GRCh38)
Location 8:67835018-67835040
Sequence GGCACACGGTCTCTGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042356576_1042356582 24 Left 1042356576 8:67835018-67835040 CCTGCACACAGAGACCGTGTGCC No data
Right 1042356582 8:67835065-67835087 TGGGACAAAATGTTAACAATTGG No data
1042356576_1042356580 4 Left 1042356576 8:67835018-67835040 CCTGCACACAGAGACCGTGTGCC No data
Right 1042356580 8:67835045-67835067 CATGCAAATGATAAAGCAAATGG No data
1042356576_1042356581 5 Left 1042356576 8:67835018-67835040 CCTGCACACAGAGACCGTGTGCC No data
Right 1042356581 8:67835046-67835068 ATGCAAATGATAAAGCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042356576 Original CRISPR GGCACACGGTCTCTGTGTGC AGG (reversed) Intergenic
No off target data available for this crispr