ID: 1042358442

View in Genome Browser
Species Human (GRCh38)
Location 8:67855070-67855092
Sequence GAGCCTCAGCAGGAGATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042358439_1042358442 3 Left 1042358439 8:67855044-67855066 CCAGGGAGGGTGTGCTTCAAGCA No data
Right 1042358442 8:67855070-67855092 GAGCCTCAGCAGGAGATCTCTGG No data
1042358433_1042358442 24 Left 1042358433 8:67855023-67855045 CCATCCTGTTGTTACTTGGCACC No data
Right 1042358442 8:67855070-67855092 GAGCCTCAGCAGGAGATCTCTGG No data
1042358435_1042358442 20 Left 1042358435 8:67855027-67855049 CCTGTTGTTACTTGGCACCAGGG No data
Right 1042358442 8:67855070-67855092 GAGCCTCAGCAGGAGATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042358442 Original CRISPR GAGCCTCAGCAGGAGATCTC TGG Intergenic
No off target data available for this crispr