ID: 1042367881

View in Genome Browser
Species Human (GRCh38)
Location 8:67957398-67957420
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042367879_1042367881 29 Left 1042367879 8:67957346-67957368 CCTCACTCTATTATTCAGCTTAA 0: 1
1: 0
2: 0
3: 12
4: 181
Right 1042367881 8:67957398-67957420 TGTGCTCCCTGGAGCTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr