ID: 1042368052

View in Genome Browser
Species Human (GRCh38)
Location 8:67959193-67959215
Sequence TTGAAAACTAGATCCTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042368052_1042368060 19 Left 1042368052 8:67959193-67959215 CCAAGGAAGGATCTAGTTTTCAA 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1042368060 8:67959235-67959257 GGCAGGACTTGAGGGAAGTGGGG No data
1042368052_1042368057 11 Left 1042368052 8:67959193-67959215 CCAAGGAAGGATCTAGTTTTCAA 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1042368057 8:67959227-67959249 TTTAAAGTGGCAGGACTTGAGGG No data
1042368052_1042368059 18 Left 1042368052 8:67959193-67959215 CCAAGGAAGGATCTAGTTTTCAA 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1042368059 8:67959234-67959256 TGGCAGGACTTGAGGGAAGTGGG No data
1042368052_1042368054 -2 Left 1042368052 8:67959193-67959215 CCAAGGAAGGATCTAGTTTTCAA 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1042368054 8:67959214-67959236 AAAGAAAGGTCTCTTTAAAGTGG No data
1042368052_1042368056 10 Left 1042368052 8:67959193-67959215 CCAAGGAAGGATCTAGTTTTCAA 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1042368056 8:67959226-67959248 CTTTAAAGTGGCAGGACTTGAGG No data
1042368052_1042368055 2 Left 1042368052 8:67959193-67959215 CCAAGGAAGGATCTAGTTTTCAA 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1042368055 8:67959218-67959240 AAAGGTCTCTTTAAAGTGGCAGG No data
1042368052_1042368058 17 Left 1042368052 8:67959193-67959215 CCAAGGAAGGATCTAGTTTTCAA 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1042368058 8:67959233-67959255 GTGGCAGGACTTGAGGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042368052 Original CRISPR TTGAAAACTAGATCCTTCCT TGG (reversed) Intronic
900855002 1:5173908-5173930 CTGAAAGCTACATGCTTCCTCGG + Intergenic
902939190 1:19787515-19787537 CTGAAAGCTAGTTCATTCCTCGG - Intronic
903695230 1:25201404-25201426 TTGGTAATTAGATCCTTCCTTGG - Intergenic
906899267 1:49815841-49815863 TTGAAAACTAGCTGTTTCTTAGG + Intronic
908878664 1:68706443-68706465 TTGATAATTAGATCCCACCTAGG + Intergenic
910266422 1:85342615-85342637 TAGAAAACTAGAAACTTCTTAGG - Intronic
910744950 1:90563408-90563430 GTGCAAACTAGCTCCTACCTAGG + Intergenic
911720482 1:101186091-101186113 TTGAAAGCTTAATTCTTCCTGGG + Intergenic
913699509 1:121360935-121360957 TTGAAAACTGGATTCTTTTTTGG + Intronic
914138036 1:144919100-144919122 TTGAAAACTGGATTCTTTTTTGG - Intronic
917469074 1:175310504-175310526 TTGAAATCTAAATGATTCCTAGG + Intergenic
917888484 1:179412620-179412642 TAGAAATCTAGATCATTACTGGG + Intronic
919527906 1:198677883-198677905 TTCAAAACTAGGTCATTCCGAGG + Intronic
920486918 1:206379644-206379666 TTGAAAACTGGATTCTTTTTTGG + Intronic
923202482 1:231725683-231725705 TTGAAGTCAAGAACCTTCCTGGG + Intronic
924504741 1:244671247-244671269 CTGACAACTAGATCATCCCTCGG - Intronic
1063686967 10:8246175-8246197 TTTAAAACTTGATGATTCCTTGG + Intergenic
1065181626 10:23131948-23131970 TTCATAAATAGTTCCTTCCTTGG - Intergenic
1066312178 10:34207781-34207803 TTAAAAACTAGATTCATGCTGGG - Intronic
1066409632 10:35154263-35154285 TTGCCATCTACATCCTTCCTAGG - Intronic
1066482652 10:35812062-35812084 GTGAATAGAAGATCCTTCCTGGG - Intergenic
1066583202 10:36902850-36902872 TTGAACACCAACTCCTTCCTGGG + Intergenic
1069090940 10:64197619-64197641 TTGAGGACTAGCTACTTCCTAGG + Intergenic
1069999793 10:72367848-72367870 TTGAGAACTGGATGCTTCCCAGG + Exonic
1073344141 10:102769290-102769312 TTGAAAACAAAAACCTTCTTTGG + Intronic
1079635668 11:22737589-22737611 ATGAAGACTAGATCCTTTCCTGG + Intronic
1080140235 11:28909333-28909355 TTTAAAACAACATCCTTGCTTGG + Intergenic
1084911311 11:72391702-72391724 CTGAACAGTAGCTCCTTCCTGGG + Intronic
1088012805 11:105023324-105023346 TTGAACTCTAGATTCTTCCCTGG + Intergenic
1088057410 11:105601744-105601766 TTGATAACTAGATTCCTCATAGG - Intergenic
1088070790 11:105781992-105782014 TGGAAAACAAGATTTTTCCTAGG - Intronic
1088085114 11:105968654-105968676 TTGAAAACTTGATCCTTTGATGG + Intronic
1089113464 11:116074973-116074995 TTTGTAACTAGTTCCTTCCTTGG + Intergenic
1089165572 11:116473532-116473554 TTGGAAACTGGAACCTGCCTTGG + Intergenic
1093175306 12:15906675-15906697 GTGAAAGCTGGATTCTTCCTGGG - Intergenic
1095538467 12:43279830-43279852 ATGAAACCTAGATCCTTCACAGG + Intergenic
1097799274 12:63895217-63895239 CTGAAGACTAGAGCCTTCTTTGG + Intronic
1099535238 12:83835194-83835216 TTAAAACCTAGATCCTTAGTGGG + Intergenic
1099970701 12:89496964-89496986 TTGAAAACTATTTCCTACCATGG - Intronic
1102027495 12:109721818-109721840 CTGAGAGCTAGGTCCTTCCTGGG + Intronic
1104227218 12:126847302-126847324 TTGGAAACAAGATGTTTCCTTGG - Intergenic
1104302799 12:127581007-127581029 TTGGAAACAAGATGCTTCCATGG - Intergenic
1107634096 13:42374567-42374589 TTGAAAACTGCATCCTTCAGAGG + Intergenic
1110268332 13:73565097-73565119 TTTATAACTAAATCCTGCCTGGG - Intergenic
1111244746 13:85521616-85521638 TTGAAAACAAAAACCTTCATTGG - Intergenic
1116596951 14:46861809-46861831 TTAAGAACTAGAAACTTCCTGGG - Intronic
1118984202 14:70739638-70739660 TTGAAAAAAAAACCCTTCCTTGG + Intronic
1119913589 14:78374056-78374078 CTAAAAACTAGGTCCGTCCTGGG + Intronic
1120375208 14:83696002-83696024 TAGAAAACAAAATCCTACCTAGG + Intergenic
1124338485 15:28874918-28874940 TTGAAAACTTGATCCTGGCCTGG + Intergenic
1126619710 15:50625385-50625407 ATGAAGACTATATCCTTGCTAGG - Intronic
1127656375 15:61060184-61060206 TTGTAAACTAAATCCTTTCAGGG + Intronic
1129346299 15:74922089-74922111 TTTAAAACGAGATCCCACCTGGG + Intronic
1131206568 15:90453620-90453642 TTGAAAACAAGATCTAGCCTAGG + Intronic
1131466638 15:92660783-92660805 TTCCTAACCAGATCCTTCCTGGG - Intronic
1135012356 16:18893325-18893347 TTAAAAACTAGATTTTTGCTGGG + Intronic
1135319221 16:21480581-21480603 TTAAAAACTAGATTTTTGCTGGG + Intergenic
1135372117 16:21912374-21912396 TTAAAAACTAGATTTTTGCTGGG + Intergenic
1135439669 16:22458330-22458352 TTAAAAACTAGATTTTTGCTGGG - Intergenic
1136329522 16:29562654-29562676 TTAAAAACTAGATTTTTGCTGGG + Intergenic
1136444151 16:30302361-30302383 TTAAAAACTAGATTTTTGCTGGG + Intergenic
1138473541 16:57257307-57257329 TTTAGAACTAAATCCTTGCTAGG - Intronic
1140488887 16:75317489-75317511 ATGGAAACTAGATTCTGCCTGGG + Intronic
1140620590 16:76726188-76726210 TTGCAAACTTGATTCTTTCTGGG - Intergenic
1147250071 17:39147861-39147883 AAGAAAACTAGACTCTTCCTGGG - Intronic
1147499344 17:40947868-40947890 TTGGAAACTCAAGCCTTCCTAGG - Intergenic
1148756975 17:49978326-49978348 TTGAAAGCCAGCTCCTTCATGGG - Intergenic
1153756802 18:8292282-8292304 TTCAAAACTGGATCCATCTTAGG + Intronic
1156009506 18:32480253-32480275 TTGCAATCTACGTCCTTCCTGGG - Intergenic
1156664384 18:39388168-39388190 CTGAAAACTAGATTCTTTTTAGG + Intergenic
1156740679 18:40324122-40324144 TTTAAAAAGAGATCCTTCCCAGG + Intergenic
1157602556 18:48902856-48902878 CTGAAAAATAGAACCATCCTAGG - Intergenic
1158033847 18:53000523-53000545 TTAAAAACAGGATCATTCCTAGG - Intronic
1159114330 18:64095358-64095380 TTCAAAACTAGCTCCTTTCCTGG - Intergenic
1161318311 19:3629206-3629228 TTGAAAACAAGATCCTGGCCAGG - Intergenic
1162632982 19:11943526-11943548 TTAAAAACTAGTTCTTTTCTAGG - Intronic
1164711163 19:30358141-30358163 CTGAATTCTAGATCATTCCTAGG + Intronic
1167340784 19:48914644-48914666 TTGAAAACAAGATGCGTCCTGGG + Intronic
926822178 2:16864351-16864373 TTGAAAACGTGATGCTTCCTGGG + Intergenic
928209054 2:29310372-29310394 TTGAAAACTACATCCTTAGTTGG + Intronic
930905831 2:56566217-56566239 TTGAAAATTAAGTTCTTCCTTGG + Intergenic
933648157 2:84828768-84828790 TTGAAAATTAGATCCTTGTCCGG + Intronic
936031247 2:109072456-109072478 TTGAAAACCAGGACCTTCTTTGG - Intergenic
937194641 2:120141916-120141938 TGGAAAACTTGCTACTTCCTTGG - Intronic
937226996 2:120375777-120375799 GTGAACCCTAGGTCCTTCCTGGG + Intergenic
938081582 2:128373134-128373156 TAGAACCCTAGAGCCTTCCTGGG - Intergenic
940627669 2:156195583-156195605 TTGAAAACAAGATTTTTACTTGG - Intergenic
941826474 2:169903073-169903095 TTGAAAACTTGACCCTTAGTAGG + Intronic
942652383 2:178182211-178182233 TTTAAAATTAGATCCTGGCTGGG + Intergenic
942800570 2:179870665-179870687 TTGGAAACAAGAAACTTCCTGGG + Intergenic
944183692 2:196925850-196925872 TTGGAAACTAGATCCCCTCTTGG - Intronic
944572327 2:201057080-201057102 TTGAGAAATAGCTCCTTGCTTGG + Intronic
945215162 2:207425647-207425669 TTAAAAAGTAGATCTATCCTTGG + Intergenic
947294162 2:228612589-228612611 TTGTAAACCAGATCCATCTTGGG + Intergenic
1169172218 20:3473941-3473963 AAGAAAACTAGATCCTGTCTTGG + Intronic
1177000121 21:15601987-15602009 TTGGAAACTTATTCCTTCCTTGG - Intergenic
1178900696 21:36596238-36596260 TTCAAATCTAGAGCTTTCCTTGG + Intergenic
1181116266 22:20634240-20634262 TGGAAAACCAGGTCCTGCCTCGG + Intergenic
1182324961 22:29505518-29505540 ATGAAAACCTGATCCTTGCTGGG - Intergenic
1183233697 22:36599759-36599781 TTAAAAAATAGAGCATTCCTAGG - Intronic
1183453450 22:37908804-37908826 TTGAAGACTATATTCTCCCTAGG - Intronic
1184762367 22:46551781-46551803 TTAAAAATGAGATGCTTCCTGGG - Intergenic
949865908 3:8547100-8547122 TTGAAAACTACAGTGTTCCTTGG + Intronic
950470656 3:13183757-13183779 TTGAAAACTGGACCCTTGCTTGG + Intergenic
955050322 3:55404227-55404249 TTGCTCACTGGATCCTTCCTTGG - Intergenic
957509806 3:81172786-81172808 TTGAAAGCTAGTTCATTCCAGGG - Intergenic
957668087 3:83262588-83262610 GTGAAAACTAGATCCATCACAGG - Intergenic
958599483 3:96276813-96276835 TTCAAAACTAGTGGCTTCCTTGG - Intergenic
958711923 3:97727158-97727180 TAGAAAACAGGATGCTTCCTTGG + Intronic
959153677 3:102639804-102639826 ATAAAACCTAGTTCCTTCCTTGG - Intergenic
963820298 3:149884371-149884393 TTGAATACTAGATCATTCAGAGG - Intronic
965225378 3:165982079-165982101 TTGAACACTCGATACTTTCTAGG + Intergenic
966630977 3:182074670-182074692 TTGAAACCCATTTCCTTCCTAGG - Intergenic
966710711 3:182969649-182969671 TTGAAAACTTGATAATACCTAGG - Intronic
967906353 3:194504103-194504125 TTGCAAATTATATCCATCCTGGG - Intergenic
968141775 3:196263925-196263947 TTTAAAACCAGATCCTGGCTGGG - Intronic
969530559 4:7728145-7728167 TTGGAAACCAGCTCCTTCCCTGG - Intronic
970454062 4:16204264-16204286 CTGAAATTTAGTTCCTTCCTAGG + Intronic
970525043 4:16923626-16923648 ATGAAACCTAGCTCTTTCCTAGG - Intergenic
975696554 4:77019531-77019553 TTGAAAAATAGTTCTTCCCTAGG + Intronic
976339246 4:83927461-83927483 TTGAAATCAAGATGCTTTCTGGG - Intergenic
978185323 4:105850465-105850487 ATGAAAAATACATCCTTCTTGGG - Intronic
979323731 4:119354538-119354560 TTGTAGACTATATCCTTCCAAGG - Intergenic
980791662 4:137628700-137628722 ATGAAAGCTTGATGCTTCCTCGG + Intergenic
980936212 4:139228074-139228096 CTCAAAAATAGCTCCTTCCTAGG - Intergenic
983241566 4:165239205-165239227 TTGTAGACTATATCCTTCCAAGG - Intronic
984018514 4:174455160-174455182 TTTAAAATTAGCTCCTTGCTTGG - Intergenic
986182593 5:5407426-5407448 TGGAAAACTGGTTCCATCCTGGG + Intergenic
987572689 5:19685643-19685665 TTGAAAACTGGATCCAACCAGGG - Intronic
987704237 5:21443128-21443150 TTGAAAAATACAACCTTCCTAGG - Intergenic
989321599 5:40141249-40141271 TTGATAAGTAGATACTTCCCAGG + Intergenic
995199820 5:109413416-109413438 GTGAAACCAAGAACCTTCCTGGG - Intergenic
999824195 5:155258460-155258482 TTTAAAGCGAAATCCTTCCTTGG - Intergenic
1001160001 5:169304292-169304314 TTGGCACCTAGATCCTGCCTTGG - Intergenic
1001761693 5:174213078-174213100 TTGAGCACAAGTTCCTTCCTGGG - Intronic
1003738259 6:8903151-8903173 TTGAAAAATAGACCCATCCCTGG - Intergenic
1004092302 6:12516190-12516212 ATGAAAACTAGAGCCTGCCCAGG + Intergenic
1004299769 6:14446636-14446658 TGGAACATTAGATCCTTCCCTGG - Intergenic
1004758804 6:18642894-18642916 TTGAAAGCTGGATCCTTGCCAGG - Intergenic
1006332819 6:33404579-33404601 TTGTATACTACATCCTTCCTTGG + Intronic
1008284800 6:49636062-49636084 TTAAAAACAAAATCCTTCCTTGG - Intronic
1008290031 6:49704486-49704508 TTGAGCCCCAGATCCTTCCTTGG - Intronic
1010294304 6:74178321-74178343 TTGCAAAATAGCTCATTCCTAGG + Intergenic
1010749524 6:79602437-79602459 TTGAAAATCAGATCTTTCGTAGG - Intergenic
1013074285 6:106756861-106756883 TTTGAAACCAGAGCCTTCCTTGG + Intergenic
1015683819 6:135837106-135837128 TATAAAACATGATCCTTCCTTGG + Intergenic
1015723077 6:136266266-136266288 CTGAAAACTAGTTCCTTCCATGG - Intronic
1017647734 6:156554677-156554699 TTTAAAACCAGAACATTCCTGGG + Intergenic
1018708722 6:166482499-166482521 TAGAAAACTATTTCTTTCCTCGG - Intronic
1019221687 6:170478391-170478413 TTGAAAACATGCACCTTCCTGGG - Intergenic
1021409309 7:20311473-20311495 TTCAAATCTAGTTCCTTCTTAGG + Intergenic
1024863840 7:53880372-53880394 TTGAAAATCAGTTCCTTCCTGGG + Intergenic
1027171150 7:75873555-75873577 TTGATAACTACAGGCTTCCTTGG + Intronic
1028097956 7:86786096-86786118 ATGAATACCAGATGCTTCCTTGG - Intronic
1028178779 7:87691244-87691266 TTGAAAAGTACATACTTCTTGGG + Intronic
1028406749 7:90483716-90483738 TTGGAAACTTGCTCCTTCCTTGG + Intronic
1030275469 7:107716758-107716780 TTGAAAACGACATCATCCCTTGG + Exonic
1038164381 8:25071136-25071158 TTGAAAATGAGATGCTTTCTGGG + Intergenic
1038320264 8:26519349-26519371 CTGAAAACTACTTCATTCCTTGG + Intronic
1038372529 8:27008398-27008420 TTGTAAACTATTTCCTCCCTGGG + Intergenic
1042368052 8:67959193-67959215 TTGAAAACTAGATCCTTCCTTGG - Intronic
1044858337 8:96497591-96497613 TTGAAAACTAGTTCCACCCAGGG - Intronic
1045931802 8:107635773-107635795 TTGCAAACTTAATCTTTCCTGGG - Intergenic
1047222499 8:122929913-122929935 ACCAAAACTAGATCCTTCTTTGG - Intronic
1047831717 8:128639395-128639417 TTCAAGACCAGATCCTTCTTTGG - Intergenic
1047961412 8:130014772-130014794 TTGCACTCTAGATCCTTGCTGGG - Intronic
1052024944 9:23563725-23563747 TTGAAAACGAGGCACTTCCTGGG + Intergenic
1052821408 9:33140494-33140516 TTAAAAAAAAAATCCTTCCTTGG + Intronic
1056224401 9:84481165-84481187 TTGGAACCAAGATTCTTCCTTGG - Intergenic
1185933860 X:4233673-4233695 TTGAAAGCTTGGCCCTTCCTTGG + Intergenic
1187611694 X:20950436-20950458 TTGTAAAGTAGATTCTTCCAGGG - Intergenic
1187738157 X:22325401-22325423 TTGAAAACTGGATCCTTGCCAGG - Intergenic
1187833225 X:23404179-23404201 TTGAAAACAGGATGCTTCATTGG - Exonic
1188215386 X:27470350-27470372 ATGAAAGCTAAATCCTCCCTTGG - Intergenic
1196346091 X:114661080-114661102 TTTAAAAATAGATGCTTGCTTGG - Intronic
1199932381 X:152536828-152536850 GATAAAACTAGATCCTTCCAGGG + Intergenic
1201714733 Y:17031920-17031942 TTGAAAGCTTGGCCCTTCCTTGG + Intergenic