ID: 1042368059

View in Genome Browser
Species Human (GRCh38)
Location 8:67959234-67959256
Sequence TGGCAGGACTTGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042368052_1042368059 18 Left 1042368052 8:67959193-67959215 CCAAGGAAGGATCTAGTTTTCAA 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1042368059 8:67959234-67959256 TGGCAGGACTTGAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042368059 Original CRISPR TGGCAGGACTTGAGGGAAGT GGG Intronic
No off target data available for this crispr