ID: 1042368203

View in Genome Browser
Species Human (GRCh38)
Location 8:67960401-67960423
Sequence GTCTATCCACAGACTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042368195_1042368203 19 Left 1042368195 8:67960359-67960381 CCCCTCCATAAACTCCAAGCTTA 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1042368203 8:67960401-67960423 GTCTATCCACAGACTGAGCTTGG No data
1042368198_1042368203 14 Left 1042368198 8:67960364-67960386 CCATAAACTCCAAGCTTATCTCC 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1042368203 8:67960401-67960423 GTCTATCCACAGACTGAGCTTGG No data
1042368196_1042368203 18 Left 1042368196 8:67960360-67960382 CCCTCCATAAACTCCAAGCTTAT 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1042368203 8:67960401-67960423 GTCTATCCACAGACTGAGCTTGG No data
1042368201_1042368203 -8 Left 1042368201 8:67960386-67960408 CCTCTCCTCTGTCTTGTCTATCC 0: 1
1: 0
2: 3
3: 34
4: 419
Right 1042368203 8:67960401-67960423 GTCTATCCACAGACTGAGCTTGG No data
1042368199_1042368203 5 Left 1042368199 8:67960373-67960395 CCAAGCTTATCTCCCTCTCCTCT 0: 1
1: 0
2: 3
3: 62
4: 662
Right 1042368203 8:67960401-67960423 GTCTATCCACAGACTGAGCTTGG No data
1042368197_1042368203 17 Left 1042368197 8:67960361-67960383 CCTCCATAAACTCCAAGCTTATC 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1042368203 8:67960401-67960423 GTCTATCCACAGACTGAGCTTGG No data
1042368200_1042368203 -7 Left 1042368200 8:67960385-67960407 CCCTCTCCTCTGTCTTGTCTATC 0: 1
1: 1
2: 2
3: 59
4: 549
Right 1042368203 8:67960401-67960423 GTCTATCCACAGACTGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042368203 Original CRISPR GTCTATCCACAGACTGAGCT TGG Intronic
No off target data available for this crispr