ID: 1042374403

View in Genome Browser
Species Human (GRCh38)
Location 8:68032596-68032618
Sequence TGGTCCCTTCTGGGGAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042374395_1042374403 8 Left 1042374395 8:68032565-68032587 CCCATCGAGGGGGGAACTTGGTT 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1042374403 8:68032596-68032618 TGGTCCCTTCTGGGGAGTTCAGG No data
1042374385_1042374403 20 Left 1042374385 8:68032553-68032575 CCAGCCCACCACCCCATCGAGGG 0: 1
1: 0
2: 0
3: 31
4: 526
Right 1042374403 8:68032596-68032618 TGGTCCCTTCTGGGGAGTTCAGG No data
1042374394_1042374403 9 Left 1042374394 8:68032564-68032586 CCCCATCGAGGGGGGAACTTGGT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1042374403 8:68032596-68032618 TGGTCCCTTCTGGGGAGTTCAGG No data
1042374391_1042374403 15 Left 1042374391 8:68032558-68032580 CCACCACCCCATCGAGGGGGGAA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1042374403 8:68032596-68032618 TGGTCCCTTCTGGGGAGTTCAGG No data
1042374382_1042374403 26 Left 1042374382 8:68032547-68032569 CCTGTCCCAGCCCACCACCCCAT 0: 1
1: 0
2: 5
3: 146
4: 1242
Right 1042374403 8:68032596-68032618 TGGTCCCTTCTGGGGAGTTCAGG No data
1042374396_1042374403 7 Left 1042374396 8:68032566-68032588 CCATCGAGGGGGGAACTTGGTTT 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1042374403 8:68032596-68032618 TGGTCCCTTCTGGGGAGTTCAGG No data
1042374392_1042374403 12 Left 1042374392 8:68032561-68032583 CCACCCCATCGAGGGGGGAACTT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1042374403 8:68032596-68032618 TGGTCCCTTCTGGGGAGTTCAGG No data
1042374390_1042374403 16 Left 1042374390 8:68032557-68032579 CCCACCACCCCATCGAGGGGGGA 0: 1
1: 0
2: 0
3: 12
4: 262
Right 1042374403 8:68032596-68032618 TGGTCCCTTCTGGGGAGTTCAGG No data
1042374383_1042374403 21 Left 1042374383 8:68032552-68032574 CCCAGCCCACCACCCCATCGAGG 0: 1
1: 0
2: 0
3: 23
4: 258
Right 1042374403 8:68032596-68032618 TGGTCCCTTCTGGGGAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042374403 Original CRISPR TGGTCCCTTCTGGGGAGTTC AGG Intronic
No off target data available for this crispr