ID: 1042374852

View in Genome Browser
Species Human (GRCh38)
Location 8:68038642-68038664
Sequence CTGGGATTCTTGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 330}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042374852 Original CRISPR CTGGGATTCTTGAAGGAAGA GGG (reversed) Intronic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
901178933 1:7326524-7326546 CTGGTATCCTTAAAGGAAGAGGG + Intronic
901671510 1:10858765-10858787 CTGGAATTAGTGAAGGAAGCAGG + Intergenic
903197953 1:21707505-21707527 CTGGGATTTTTGAAGATTGAAGG - Intronic
903643582 1:24876700-24876722 CTGGGAGTCATGAGGGAGGATGG - Intergenic
903648410 1:24908750-24908772 CTGGGATGCTGGGAGGCAGAGGG - Intronic
903783996 1:25844757-25844779 CTGGGAAGCATAAAGGAAGAAGG - Intronic
904366224 1:30012516-30012538 GAGGGCTTCTTGAAGGAAGGAGG - Intergenic
904764400 1:32832524-32832546 CTGGGTTCCTGGAAGGCAGAAGG - Intronic
905208062 1:36354230-36354252 CTGGGATTCCTGGAGGAAGTGGG + Intronic
905339742 1:37270344-37270366 CTCAGTTTCATGAAGGAAGAAGG + Intergenic
905609441 1:39337383-39337405 CTTGAAATCTTCAAGGAAGATGG - Intronic
906166857 1:43693024-43693046 CTGGGACTCTTGAGGGCAGGCGG - Intronic
907055484 1:51363343-51363365 TTGGTTTTCTTGAAGGAAAATGG - Intronic
907418221 1:54329112-54329134 CTGGACTTCTGGAAGGAAGGGGG + Intronic
907648136 1:56264710-56264732 CTGGGATTCGTGACCTAAGATGG + Intergenic
908171785 1:61512309-61512331 CTGGCATTCTGGGAGCAAGATGG - Intergenic
908653611 1:66363604-66363626 ATGGCATTTTTGAAGGAGGATGG - Intronic
909013612 1:70360403-70360425 CTTGTGTTCTTGAAGGAAGCAGG - Intronic
910234308 1:85019623-85019645 CAGGCATTTTTGAAGGAACATGG + Intronic
910290584 1:85596660-85596682 CTGGAATTGTAGAAGGAAGCGGG - Intergenic
911803378 1:102174155-102174177 CTGGGATTCCTGGAGAAATATGG - Intergenic
912755228 1:112318938-112318960 CTGGCACTCTTTCAGGAAGAAGG - Intergenic
913072135 1:115309101-115309123 CTGGGATACCTGAAGCAATAAGG + Intronic
913280564 1:117181436-117181458 CAGGGATTCCTAAAGGGAGAAGG - Intronic
914251792 1:145927808-145927830 CTGGGATTTTTGAAAGAAAAGGG - Intergenic
914406341 1:147377494-147377516 CTGTGGCTCTTGGAGGAAGAAGG - Intergenic
914478118 1:148040929-148040951 CTTGGATGCTGGAAGCAAGACGG + Intergenic
914697311 1:150096698-150096720 GTGGAAATTTTGAAGGAAGAAGG + Intronic
915564811 1:156707388-156707410 CTGGGCTTCTGCAAGGAAGAGGG + Intergenic
915920924 1:159974563-159974585 CTGGGAGCCTTTAAGGAAGAAGG - Intergenic
916484400 1:165245251-165245273 CTAGGATTCTAGAGGGAGGAAGG - Intronic
916820910 1:168397833-168397855 CTGCGCTGCTTGAAGGAGGAAGG + Intergenic
917973615 1:180224696-180224718 CTGGGATCCTTAGAGGAAGACGG - Intergenic
918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG + Intergenic
918248609 1:182682251-182682273 CTGGGATTGAGAAAGGAAGATGG + Intronic
918908685 1:190534708-190534730 CTAGGATTCTTCAAGTAAAAAGG + Intergenic
919147461 1:193653953-193653975 CAGGGAATCTTGAAAGAAGCAGG - Intergenic
919848331 1:201655565-201655587 CTGGGCCTCCTGAAGGAAGCAGG + Intronic
920521268 1:206628831-206628853 CTGGGAATCTTGAAGGAAAGAGG + Intergenic
920548573 1:206838993-206839015 CTTTGCTTCTTGAATGAAGATGG + Intronic
920559609 1:206930025-206930047 ATGGGTCCCTTGAAGGAAGAGGG - Exonic
920686456 1:208112740-208112762 CTGGGATTATTTAATAAAGACGG - Intronic
920826348 1:209427218-209427240 ATGCTATTCTGGAAGGAAGAGGG + Intergenic
920866610 1:209758709-209758731 CAGGGACTGATGAAGGAAGAGGG - Exonic
922068200 1:222164949-222164971 GTGGGGTGCTTGGAGGAAGAGGG + Intergenic
924849235 1:247808261-247808283 CAGGGACTCTTTAAGGAAGGAGG + Intergenic
1063538384 10:6908010-6908032 CTGGGATGCTTAAAGGATGGAGG - Intergenic
1065545234 10:26812746-26812768 CTGGTATTCTTGAAAGAAGAGGG - Intronic
1066065979 10:31761091-31761113 CTGGGATCCTTGAGGCAAGCAGG - Intergenic
1067077476 10:43196434-43196456 ATGGGAGTCTGTAAGGAAGAGGG - Intronic
1067774483 10:49153062-49153084 CTGGGATTTATGAGAGAAGATGG - Intergenic
1068974383 10:62992776-62992798 CTGGGACTCTTGTAGAAACACGG - Intergenic
1069189870 10:65473679-65473701 CTGGAATATTTGGAGGAAGAAGG - Intergenic
1069790308 10:71015057-71015079 CTGTGATTCTTAGAGGAGGAAGG - Intergenic
1070340840 10:75496944-75496966 CTAGGATTCCTGAGGGGAGAGGG - Intronic
1072071436 10:91921879-91921901 CTGGGAGCCTTCCAGGAAGAGGG - Intergenic
1073223761 10:101898539-101898561 CTGAGATACCTGAAGGAAGCAGG + Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073469151 10:103712093-103712115 CTGGGATCTTTTAAGGGAGATGG + Intronic
1078302817 11:10150462-10150484 ATGGGATTACTGATGGAAGAGGG + Intronic
1078991787 11:16655151-16655173 CTGGGATTCTAGGATGCAGATGG + Intronic
1079946987 11:26756098-26756120 TTAGGTTTCATGAAGGAAGAGGG + Intergenic
1081625326 11:44652004-44652026 CGGGGATTTTGCAAGGAAGAAGG + Intergenic
1084069238 11:66723366-66723388 CTCGGGTTCTGGAAGGAAGGAGG + Intronic
1084710112 11:70838933-70838955 CTGGGACCCTTGACAGAAGAGGG - Intronic
1085025010 11:73231235-73231257 CTGGGAGTCTTGGTGAAAGAAGG + Intronic
1087415321 11:97847640-97847662 CTGGCATTCTGGTAGAAAGAGGG + Intergenic
1089118964 11:116118466-116118488 CTGGGCTTCTTTCAGGAGGAGGG - Intergenic
1089802319 11:121043685-121043707 CTGGGAGTGGAGAAGGAAGATGG - Intronic
1091279848 11:134375582-134375604 TTGGGATTCTGGAAGGAACTCGG + Exonic
1091473937 12:753514-753536 CTCGGATTCGTGAACGAAAAGGG - Exonic
1091853929 12:3723703-3723725 CTGGGGTTCTTGTAGGCAGGAGG + Intronic
1092162406 12:6323120-6323142 TTGGGATTCTGAAAGGGAGAAGG - Intronic
1093503531 12:19838305-19838327 CTGGTATTCTTCTAAGAAGAGGG - Intergenic
1093822483 12:23638296-23638318 CTGGGATTCTTGACTAACGATGG + Intronic
1093872845 12:24313142-24313164 CTGGGACCCTTCAAGGCAGAAGG - Intergenic
1094359560 12:29615619-29615641 CTGGGAGTCCTGATGGATGAGGG - Intronic
1094714128 12:32994739-32994761 CTAGGATGCCTGAAAGAAGAAGG - Intergenic
1096268420 12:50143494-50143516 CTGGGATTTTTGAAGGCTGAGGG + Intronic
1097229185 12:57498766-57498788 CAGGCATTTTTGAGGGAAGATGG + Intronic
1098904948 12:76152484-76152506 CTGGGATCCTTGAATGAGGTAGG - Intergenic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099506913 12:83489484-83489506 ATGTAATTCTTTAAGGAAGAGGG - Intergenic
1100346531 12:93737074-93737096 CTGGGATAGTTGAGGGAAGGTGG + Intronic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1102396285 12:112588999-112589021 GTGGGATTCTTGGGGGAAGGGGG + Intronic
1103772949 12:123342762-123342784 CAGGGATTCTTGGAGGCTGAAGG - Intronic
1104200817 12:126586871-126586893 CAGGGCTTCTTTAAGGAAAAGGG + Intergenic
1108424218 13:50282212-50282234 TTGGCATTCTTGAATGAGGAGGG + Intronic
1108446030 13:50509986-50510008 ATGGTATTCTTGAAGGGAGTGGG + Intronic
1109002092 13:56818274-56818296 CTGCCATTCTTGAAGGAGTAAGG - Intergenic
1109305059 13:60629434-60629456 CTAGGGTACTAGAAGGAAGATGG - Intergenic
1109531996 13:63662221-63662243 CAGGGATTCTTGAGAAAAGAGGG - Intergenic
1110419781 13:75293254-75293276 CAGGGAGTCTTTAATGAAGAGGG + Intronic
1110816555 13:79866761-79866783 CTGGGAATCTGGTAGGAACAAGG - Intergenic
1111471585 13:88690387-88690409 CTGGCATTCATGAGGGAAAAAGG + Intergenic
1112849246 13:103684430-103684452 CGTGGATTCATGAAGGAAGAGGG - Intergenic
1114251674 14:20967144-20967166 CTGGGAATGTTGGGGGAAGAAGG + Intergenic
1115047629 14:29016172-29016194 CTGAGATCCTTGGAAGAAGAAGG - Intergenic
1115105930 14:29762083-29762105 GTGGGGCTCTTGAAAGAAGATGG + Intronic
1115500885 14:34048648-34048670 TTGGGATTCTTGAGAGAATATGG - Intronic
1116690917 14:48104357-48104379 CTGGGACCCTAGAAGCAAGATGG + Intergenic
1117413034 14:55467991-55468013 CTGGGCTTCTAGAAGGGCGACGG + Intergenic
1118359345 14:65043032-65043054 CTGGGACCCTTGATGGAAGTGGG - Intronic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1119371210 14:74145412-74145434 CTGGCATACTGTAAGGAAGAAGG - Intronic
1119771748 14:77224485-77224507 CTGGGATCCCAGAAGGAAGCAGG + Intronic
1120056240 14:79927448-79927470 CTGGGATGCCTTGAGGAAGAAGG - Intergenic
1122743421 14:103884825-103884847 CTGGGTTTCTTTACAGAAGAGGG + Intergenic
1122910450 14:104825376-104825398 GTGGGATTCATGAAGGCAGGTGG + Intergenic
1123758611 15:23415980-23416002 CTGGGGTTCTTATACGAAGAGGG + Intergenic
1125671644 15:41477795-41477817 CTGGTATTCTTGAAGGGAAAAGG + Intronic
1127371015 15:58341304-58341326 CTTGGATTCTTGAACGAAAATGG - Intronic
1127679511 15:61279616-61279638 CTGGGACTCTTCTAGCAAGAGGG - Intergenic
1128299983 15:66560577-66560599 CTGGGAATTTTGAAGGAGGAAGG - Intronic
1128632679 15:69281957-69281979 CAGGGATGCTTCATGGAAGAAGG - Intergenic
1133026816 16:2992192-2992214 CTGGGATTCTAGAAGACACAGGG + Intergenic
1133742238 16:8660508-8660530 CAGGGATTCTTCTAGGAAGTAGG - Intergenic
1133971010 16:10568009-10568031 CTGGGCTTCCTGAGGCAAGACGG - Intronic
1134457723 16:14406881-14406903 CTGGGGTTCTTATACGAAGAGGG - Intergenic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135859739 16:26044750-26044772 CTTGGATTCTGGTAGGAAGTAGG + Intronic
1137422174 16:48344593-48344615 CTTGGCTTCTTGAAGCAACATGG + Intronic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1138029754 16:53550914-53550936 CTGGGATTGGGGAAGGCAGAAGG - Intergenic
1141087538 16:81107659-81107681 CTGGGCTGCCTGCAGGAAGAGGG - Intergenic
1141362379 16:83407953-83407975 CTGGGAATGTTGTGGGAAGAGGG - Intronic
1141748784 16:85944466-85944488 CTTGAATTCTTGAAGGATGGGGG + Intergenic
1145923975 17:28632380-28632402 CTTAGATCCTTGAAAGAAGAGGG - Intronic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1147040460 17:37714360-37714382 CTTGCATTGGTGAAGGAAGAAGG - Intronic
1147450311 17:40500225-40500247 CTGGGATTCTGGAACCAAGAGGG + Intronic
1148144707 17:45355804-45355826 CTAGGGTTTTTGAAGGAGGAAGG + Intergenic
1149003824 17:51783957-51783979 CTGGGCTCCTTGAAAGAGGAGGG + Intronic
1149442960 17:56690624-56690646 GTGGGATTCTTGAAGACAAAGGG + Intergenic
1149687332 17:58543733-58543755 CTGGGATTGATGAAGCATGATGG + Exonic
1150468328 17:65414503-65414525 CTGGCATGCTTGAAAGAACAAGG + Intergenic
1150877777 17:68988412-68988434 CTGAAATTCTTGAAGGACAATGG - Intronic
1151711307 17:75808586-75808608 CTGGGATGCAGGAAGGAGGAAGG - Intronic
1153231431 18:2940563-2940585 CTTGGTTTCTTGAAAGAGGAAGG - Intronic
1154017367 18:10630950-10630972 CTGGGATTCTGATAGGAATAAGG - Intergenic
1154145211 18:11861266-11861288 CAGGGACCCTAGAAGGAAGAAGG - Intronic
1154187495 18:12198648-12198670 CTGGGATTCTGATAGGAATAAGG + Intergenic
1155028687 18:21965201-21965223 CTGGGCTTCTTGAAAGGAGTAGG + Intergenic
1155044166 18:22089002-22089024 CTGGGATTCTGCAAAGAAAATGG + Intronic
1155357208 18:24964750-24964772 CTGGGAGGCTAGAAGCAAGATGG + Intergenic
1155870824 18:31026073-31026095 CAGGGATTCTCACAGGAAGAAGG + Intronic
1156362650 18:36398046-36398068 CTGGGGTTCTTCTAGTAAGAAGG + Intronic
1156388633 18:36629500-36629522 CTGGGTTTCTTGAGGGAGGTTGG + Intronic
1156494307 18:37515928-37515950 CTGGGATGCTACAATGAAGAAGG - Intronic
1156678660 18:39562445-39562467 CTAGGATGCTTGAAGGCAGATGG + Intergenic
1156937823 18:42732492-42732514 CCAGTATTTTTGAAGGAAGACGG + Intergenic
1158607430 18:58908005-58908027 CTGTGATTCTTAAATGAAAAGGG + Intronic
1158951136 18:62496254-62496276 CTATGATCCATGAAGGAAGAAGG - Intergenic
1159657350 18:71048073-71048095 CTGAGATTGAGGAAGGAAGAAGG - Intergenic
1160178815 18:76617278-76617300 ATGGGACTCTGGAAGGGAGAGGG - Intergenic
1160376543 18:78418044-78418066 CTATGTTTCTTGAAGGAAGTTGG + Intergenic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1163189609 19:15666957-15666979 CTGGGCTTCCTGAAGGATAAGGG - Intergenic
1163221211 19:15922518-15922540 TTGGGTTTCTGGAAGGAGGATGG - Intronic
1165529178 19:36382415-36382437 CTGGAATTCTAGAGGCAAGAGGG + Intergenic
1166571957 19:43802646-43802668 CTGGGAGGGGTGAAGGAAGAAGG - Intronic
925859110 2:8157825-8157847 CTGGGGTCCTGGAAGGGAGAGGG - Intergenic
927070430 2:19523199-19523221 TAGGGAACCTTGAAGGAAGAAGG + Intergenic
927102456 2:19798670-19798692 AAGGGACTCTTGAAGGAACATGG - Intergenic
927246912 2:20964256-20964278 TGGGGATTCTTGAAGTCAGAAGG - Intergenic
927558314 2:24050822-24050844 CTGGGATTGGACAAGGAAGATGG - Intronic
928887166 2:36163013-36163035 CTGGACTTCTTGAAATAAGAAGG + Intergenic
929554371 2:42916161-42916183 ATGGGATTGTTGAAGGAAGAAGG + Intergenic
929919147 2:46160301-46160323 CTGAGAATCTGGAAGGCAGAAGG - Intronic
930602412 2:53457503-53457525 TTGGGATTTTTGAAGGAAGAAGG - Intergenic
931843279 2:66176945-66176967 ATGGCATTCTTGATGGGAGAGGG - Intergenic
932442924 2:71749247-71749269 CTGGGGTTCTAGAAGGAGGCAGG + Intergenic
932688104 2:73890796-73890818 TGGGGATTCTGGAGGGAAGAGGG - Intergenic
933318532 2:80743778-80743800 CTAGAATTCAGGAAGGAAGAGGG - Intergenic
933987310 2:87602738-87602760 CTAGGACTCTTGAAAGCAGAAGG - Intergenic
934656974 2:96121504-96121526 CTGGAAGGTTTGAAGGAAGATGG - Intergenic
935062634 2:99621762-99621784 CAGGAATTCTTGGAGGAAGTGGG + Intronic
935340651 2:102057065-102057087 CTGGGATTCTTGGAGGGGTATGG + Intergenic
935469296 2:103437596-103437618 CTGGAATGCTTAAAGAAAGAAGG + Intergenic
936306529 2:111348070-111348092 CTAGGACTCTTGAAAGCAGAAGG + Intergenic
936745971 2:115577029-115577051 ATGGGAGTATTGAAGGAACAAGG + Intronic
937002737 2:118482999-118483021 CTGGGGTTCTGGAAGGAAATGGG + Intergenic
938203502 2:129397443-129397465 ATGGCTTTCTTGAAGGAAGAGGG + Intergenic
938979107 2:136508615-136508637 CTGGGAGTTTTGAAGGGAGCAGG - Intergenic
939409397 2:141804696-141804718 CTGGGCATCTGGAAGGCAGATGG + Intronic
942465518 2:176203952-176203974 CTGGGTTTCTTGAAGCCAGGAGG + Intergenic
944254600 2:197612556-197612578 CTTGAACTCTTGAAGGAAAAAGG + Intronic
944355189 2:198779033-198779055 ATGGAACTCTTGAAGAAAGAGGG - Intergenic
944495754 2:200306433-200306455 CTGGGATTCTTCTAGAAAGTGGG + Intronic
945060609 2:205905616-205905638 GTGGGATATTTGAAAGAAGAGGG - Intergenic
945761959 2:213924458-213924480 CTGGGATCCATGAAGGCAGCAGG - Intronic
946007678 2:216539431-216539453 CTGGTGTCCTTGAAAGAAGAGGG - Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946192448 2:218014728-218014750 CTGGCATTCTGGTAGGAAAAGGG - Intergenic
946668259 2:222074162-222074184 AGGGGATTCATGAAAGAAGAGGG - Intergenic
947679975 2:232021734-232021756 CTGGGATTTTTGAAAGAGAATGG + Intronic
1169066847 20:2698548-2698570 ATGGGATGCTTGGAGGAAGGGGG + Intronic
1169927637 20:10799500-10799522 CTGGGATTAGGGAAGGGAGAGGG - Intergenic
1170562161 20:17567898-17567920 CTGGGATTATAGAAGGAACTAGG + Intronic
1172156643 20:32830477-32830499 CTGGGACACTGGAAGAAAGATGG - Intronic
1172993832 20:39055387-39055409 CTGATATTCCTTAAGGAAGAAGG - Intergenic
1173416144 20:42857879-42857901 CTGGGATTGTAGAGGGAATAGGG - Intronic
1173809908 20:45949333-45949355 CTGGGACTCCTGAAGGAACGGGG + Exonic
1174684549 20:52441133-52441155 CTGGGATTCTTGAATCACCAAGG - Intergenic
1174975802 20:55332337-55332359 CTGGCATCCTTGTAAGAAGAGGG + Intergenic
1175347278 20:58289130-58289152 CAGGGATTCTTAAAAAAAGATGG - Intergenic
1175658733 20:60794000-60794022 CTGGGAGTCTTGATGGAATGGGG - Intergenic
1175807613 20:61838473-61838495 ATGGGAGCCTTGAGGGAAGAAGG - Intronic
1176036806 20:63043603-63043625 CAAGGCTTCCTGAAGGAAGAAGG + Intergenic
1177102022 21:16909960-16909982 CTGGTATCCTGGAAGGAACAAGG - Intergenic
1178662741 21:34521041-34521063 CTGGCCTTCTTAAAGGAAAAGGG - Intronic
1178839607 21:36128343-36128365 CAGGGATTCTGGAAGGAGCACGG - Intergenic
1181362719 22:22350744-22350766 AGGAAATTCTTGAAGGAAGAAGG + Intergenic
1182435054 22:30325274-30325296 CTGGATTTCTCCAAGGAAGAAGG + Intronic
1182637880 22:31743312-31743334 CTGGGATTCTTGGAGAAATTGGG + Intronic
1183133425 22:35862607-35862629 TAGGGATACTTTAAGGAAGAAGG - Intronic
1183279875 22:36926246-36926268 CAGGGAGTCTTCAAGGCAGAAGG + Intronic
1184684827 22:46091523-46091545 GAGGGCTTCTTGGAGGAAGAGGG - Intronic
949587508 3:5456353-5456375 CTGCCATTCTTGGAGCAAGAAGG + Intergenic
950407637 3:12814631-12814653 CTGGGACTCCAGAAGGGAGAAGG - Intronic
950571411 3:13802489-13802511 CTGGAGTTCTGGAAGGAAGCAGG + Intergenic
952212856 3:31246992-31247014 CAGGGATTCTCAAAGGGAGAGGG + Intergenic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
955080733 3:55655684-55655706 CAGGGAGTCTTGGAGAAAGAAGG - Intronic
955439360 3:58939333-58939355 CTGGGATTCTAGAAAGGAAAAGG + Intronic
956870132 3:73408572-73408594 TTGGGATTCTTGGAGGAGGGGGG + Intronic
958056212 3:88415728-88415750 CTGTGGTTCTTGAAGTTAGATGG - Intergenic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
959995176 3:112672781-112672803 GTGGGATTCTGGTAGTAAGATGG - Intergenic
961072609 3:123948778-123948800 CTGAGATTCTGTAAGTAAGAGGG + Exonic
961352535 3:126313128-126313150 CTGGGGTGCTTGTAAGAAGAGGG + Intergenic
962674368 3:137743539-137743561 CTGGGATTCTGTTAAGAAGAAGG + Intergenic
963206512 3:142641764-142641786 CTGGGTTTCTTTAGGGGAGATGG + Intronic
964140097 3:153388129-153388151 CTGTGATTCTGTAAGCAAGAAGG + Intergenic
964206643 3:154182326-154182348 GTGGGATTCATGAGGGAAAAAGG + Intronic
965802091 3:172504984-172505006 CTGGCATTTTTGTAAGAAGAGGG - Intergenic
965812916 3:172610258-172610280 CTGTGCTTCTGGCAGGAAGAGGG + Intergenic
967236005 3:187384260-187384282 GTGGGATGCTGGAAGGAAGAAGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967665235 3:192164094-192164116 ATGTGCTTCTTGAAGGAGGAGGG + Intronic
968222063 3:196947038-196947060 GTGGGAGTCATGAAGGAGGACGG + Exonic
969480240 4:7443049-7443071 CTGGTATTCTCATAGGAAGAAGG - Intronic
970534296 4:17013433-17013455 CTGAGATTCTCCAAGGAAAAAGG + Intergenic
973074039 4:45900587-45900609 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
973611797 4:52643013-52643035 CTTGGATTATTGCAGGGAGAGGG + Intronic
973897566 4:55430090-55430112 CTGGGGTTCTTGAATAAAAATGG - Exonic
974018718 4:56674140-56674162 CTGGGATTTATGAAGCAGGAGGG - Intronic
974243927 4:59289565-59289587 GTGGGGTTGTTGAAGGAAGGAGG - Intergenic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
977328963 4:95612361-95612383 TTGGGATTGTTGAAGGCAGAAGG - Intergenic
978198588 4:105998442-105998464 CTGGGATTTCTGGAGGAAAAGGG + Intronic
978729859 4:112013096-112013118 CTGGGACACCTGTAGGAAGAAGG + Intergenic
979003505 4:115258776-115258798 TTGAGACTCTTAAAGGAAGAAGG + Intergenic
980740015 4:136938323-136938345 CTGGGAATCAAGAGGGAAGAAGG + Intergenic
982807139 4:159780299-159780321 CTGGGACTCTTGAATAAAAAAGG - Intergenic
984031341 4:174607574-174607596 CTGGGGTTCCTTAAGGAAAATGG + Intergenic
984410027 4:179386186-179386208 CTGAGCATCTTCAAGGAAGAGGG - Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
986369662 5:7067676-7067698 CAGGGATTCTGAAAGGAAGTTGG - Intergenic
986428037 5:7654233-7654255 CAGGGTTTCAGGAAGGAAGAAGG + Intronic
987965472 5:24866427-24866449 CAGGGATTCTTGAAGTGAGCGGG + Intergenic
988790698 5:34604775-34604797 CAGGGTTGCTTTAAGGAAGACGG + Intergenic
988947800 5:36224018-36224040 GTGGGTTTATTGAAGAAAGAAGG + Intronic
990405004 5:55480449-55480471 CTGGGTTTCTTGGTGGAAGCAGG - Intronic
990967581 5:61465580-61465602 CTTGGATTCTTGTAAGAAAATGG + Intronic
992414646 5:76540584-76540606 CTGGGATCCATGAAAGGAGAGGG + Intronic
996242472 5:121220964-121220986 CTGGGTTTCAAGAAGAAAGATGG + Intergenic
996947234 5:129084954-129084976 CTGGGCTTCTTGTAGGATCAGGG - Intergenic
997360073 5:133289377-133289399 CTGGGCTTCCTGGAAGAAGATGG - Intronic
997949526 5:138231147-138231169 CTGGAATTCTTCCAGGAAGAAGG - Intergenic
998291170 5:140916168-140916190 CTGGGACTCTTCAAGGAAGTGGG + Intronic
998401865 5:141852547-141852569 GGGGGTTTCTGGAAGGAAGAGGG + Intergenic
1003158560 6:3616897-3616919 CTGGGATTCTAGAAGGCACAGGG - Intergenic
1003601142 6:7518675-7518697 CTGGGTTCCCTGATGGAAGAGGG - Intergenic
1004423603 6:15492741-15492763 CTGGGTTTCGAGGAGGAAGATGG + Intronic
1008280637 6:49591859-49591881 CTGGAATTTTGGAAGAAAGATGG + Intergenic
1008650605 6:53557412-53557434 CTGGGGTTCCTTAAGGAAAATGG + Intronic
1009749142 6:67860967-67860989 CTGGGATTCCTTAAAGAAAACGG - Intergenic
1009802806 6:68563308-68563330 TTGGGATTCTTAAAGAAAGAAGG + Intergenic
1010052856 6:71527924-71527946 CTGGGAGTCTTTAAGAAAGAAGG - Intergenic
1010188666 6:73171346-73171368 CTGGGATACTTTGAGAAAGATGG - Intronic
1010758686 6:79697504-79697526 CTGGCATACCTGTAGGAAGAAGG + Intronic
1010879067 6:81145548-81145570 CGGGGCTTGTTGAAGGAGGATGG - Intergenic
1013067505 6:106698092-106698114 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
1013117325 6:107113555-107113577 CTTGGATTCTAGAGGAAAGATGG - Intronic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1013729291 6:113144408-113144430 CTGGTATTCGTCAAGGAAGGAGG + Intergenic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1017198136 6:151724011-151724033 CTGGAATTCTAGAAGGTAGAAGG + Intronic
1017596023 6:156029384-156029406 TGGGGATTCTTTATGGAAGATGG - Intergenic
1018538292 6:164848044-164848066 CTGGGACTCCGGAAGGAAGTGGG - Intergenic
1019133706 6:169895504-169895526 CTGAGGTTCCTGGAGGAAGAAGG - Intergenic
1020397986 7:7738977-7738999 TTTGGATTCTTGAAAGAACAGGG + Intronic
1020907749 7:14085672-14085694 CTGTGCTTCTGGAAGGGAGAAGG - Intergenic
1020924641 7:14310306-14310328 CAGGGATTCTTGAATAAAAATGG + Intronic
1022135379 7:27442700-27442722 ATGAGAGTCTTCAAGGAAGAAGG - Intergenic
1023978933 7:45054662-45054684 CTGGGATTAGTGAAAGAAGACGG - Intronic
1024798590 7:53049438-53049460 CCAGGATACTTGAAGGAAAATGG - Intergenic
1024999887 7:55307060-55307082 CTGGTATTTCTCAAGGAAGACGG + Intergenic
1026230994 7:68484056-68484078 CTGGGATACTTGAGAGAAGCTGG + Intergenic
1027267584 7:76502794-76502816 CAGGGATGCTGTAAGGAAGAAGG - Intronic
1027319395 7:77002659-77002681 CAGGGATGCTGTAAGGAAGAAGG - Intergenic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1028653126 7:93172428-93172450 CTGGGAGGCTAGAAGCAAGAAGG + Intergenic
1028889172 7:95967666-95967688 CTGGCATTCTAGCAGCAAGATGG - Intronic
1028977659 7:96932085-96932107 CTGGGAGTCAAGAATGAAGAGGG - Intergenic
1029176254 7:98666713-98666735 TTGGGATTTTTGAAGCCAGATGG - Intergenic
1030364511 7:108630172-108630194 CTGGGATTCTGGCATGGAGAGGG + Intergenic
1030685154 7:112478805-112478827 CTGGGCTTTTGGGAGGAAGAAGG + Intronic
1030878638 7:114848476-114848498 CCTGGATCCTTGAATGAAGAAGG + Intergenic
1031447124 7:121868436-121868458 ATGAGATTCTTGCAAGAAGATGG + Intergenic
1031860608 7:126975561-126975583 CTGGGAATCTTGGATGAAGGTGG + Intronic
1031863207 7:127007024-127007046 CTGGGATCCTTGATGGAAGGTGG + Intronic
1031869408 7:127075799-127075821 CTGGGATCCTGAAAGAAAGAGGG + Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032566935 7:132956098-132956120 CTGAGGTTCTCTAAGGAAGAGGG + Intronic
1032905246 7:136357295-136357317 TTGAGAATCTTGAAGTAAGATGG + Intergenic
1033142518 7:138840271-138840293 CTGGGAGCCTGGAAGGAACATGG + Exonic
1033899420 7:146116793-146116815 GTAGGGTTCTTGAAGGGAGATGG - Exonic
1034069092 7:148165266-148165288 CTGGTGTTCTTGTAAGAAGAGGG - Intronic
1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG + Intergenic
1036948899 8:13122099-13122121 CGGGGATCCTTGAAGGAGGACGG - Intronic
1037029284 8:14083221-14083243 GTGGGATCCTGGAAGGAAGCTGG + Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1037884755 8:22590040-22590062 GAGGGCTTCTTGGAGGAAGAGGG + Intronic
1038505541 8:28081571-28081593 CGAAGATTCTTTAAGGAAGATGG - Intronic
1038736871 8:30177988-30178010 CTGGGGTTCTTGAATCAAGAAGG - Intronic
1041403275 8:57467191-57467213 CTGTAATTGTTGAATGAAGATGG - Intergenic
1041957108 8:63568450-63568472 CAGGAATTTCTGAAGGAAGATGG - Intergenic
1041987613 8:63944272-63944294 TTGGGGTTCTTGAAGAAGGAAGG - Intergenic
1042374852 8:68038642-68038664 CTGGGATTCTTGAAGGAAGAGGG - Intronic
1042730644 8:71930246-71930268 CTCAGATTCTTGAAGTCAGATGG + Intronic
1047304349 8:123640913-123640935 CTGGGATTTATAAAGAAAGATGG - Intergenic
1047645789 8:126868206-126868228 CTAGGATCCTTAAATGAAGAAGG - Intergenic
1051761868 9:20476261-20476283 CTTTGAGTCTTGTAGGAAGATGG - Intronic
1055151885 9:73010331-73010353 CTGGGAGTGCTGAAGGAAGCCGG + Intronic
1055468146 9:76585620-76585642 CTGTGAGGCTTGAAGCAAGATGG + Intergenic
1055486413 9:76760460-76760482 CTGGAATTATTAAAGTAAGAAGG - Intronic
1056055952 9:82824294-82824316 CTGGGATTATAGGGGGAAGAAGG + Intergenic
1057722056 9:97540140-97540162 CTGGGAAGGTTGAAGGGAGATGG - Intronic
1059175940 9:112170281-112170303 CTGTGATTCCTGAAGACAGAGGG + Intronic
1059306026 9:113353908-113353930 CTGGGGTTCTGGGATGAAGACGG + Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1061014603 9:127974487-127974509 CTGGGAGCCTTGAAGGCAGAGGG - Intronic
1061910839 9:133722399-133722421 ATGTGATACTTCAAGGAAGAAGG + Intronic
1186289125 X:8077551-8077573 CTGGGCTACTTGAAGGATCATGG - Intergenic
1186490822 X:9970602-9970624 CAGAGATTCCTGTAGGAAGAAGG - Intergenic
1187566407 X:20454033-20454055 CTGGGGTCCTTAGAGGAAGAGGG - Intergenic
1187776139 X:22760175-22760197 CTGGAGTTCTTAAAAGAAGAGGG + Intergenic
1188609059 X:32073125-32073147 TTGGGATTTTTAAAGTAAGAAGG + Intronic
1189233537 X:39470635-39470657 TTTGGATTCATGAAGGAAGAGGG - Intergenic
1189241307 X:39526649-39526671 CTGGGATCCTTGAGAGATGAGGG + Intergenic
1189386619 X:40542062-40542084 GCAAGATTCTTGAAGGAAGAAGG + Intergenic
1193420522 X:81277868-81277890 CTAGAATTCTGGAAGGAATAAGG - Intronic
1193469525 X:81882493-81882515 TTGTCATTCTTGAAGGAAAAGGG + Intergenic
1194187871 X:90795460-90795482 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1196536268 X:116848484-116848506 CTGGGAGACTTGAAGGACCATGG - Intergenic
1196630527 X:117934122-117934144 CTGGGATTCTAAAAGGAGGAAGG + Intronic
1197233145 X:124028641-124028663 TTTGGACTCTTGGAGGAAGAAGG + Intronic
1198573146 X:137979790-137979812 CTGGGATTCTTTAAGTCACAGGG + Intergenic
1199887779 X:152039190-152039212 CTGGGATTCTTTAAAGAAAATGG - Intergenic
1200534459 Y:4377409-4377431 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1201610184 Y:15833930-15833952 CAGGTATTCTTGAAGCAAGAAGG + Intergenic
1201785969 Y:17779498-17779520 CAGGAATTGTTCAAGGAAGAGGG - Intergenic
1201815584 Y:18126490-18126512 CAGGAATTGTTCAAGGAAGAGGG + Intergenic
1202346220 Y:23930956-23930978 CAGGGATAGTTCAAGGAAGAGGG - Intergenic
1202524551 Y:25739134-25739156 CAGGGATAGTTCAAGGAAGAGGG + Intergenic