ID: 1042377554

View in Genome Browser
Species Human (GRCh38)
Location 8:68071808-68071830
Sequence TGCCCTAGTGGAAAACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042377554_1042377558 30 Left 1042377554 8:68071808-68071830 CCTGCTTGTTTTCCACTAGGGCA 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1042377558 8:68071861-68071883 CCAGCCTTCCTGGAGCATTCAGG No data
1042377554_1042377556 20 Left 1042377554 8:68071808-68071830 CCTGCTTGTTTTCCACTAGGGCA 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1042377556 8:68071851-68071873 TAGTGCAAATCCAGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042377554 Original CRISPR TGCCCTAGTGGAAAACAAGC AGG (reversed) Intronic
900502894 1:3015299-3015321 TGCCCTGGAGGAACACAGGCAGG - Intergenic
903372905 1:22848347-22848369 AGAGATAGTGGAAAACAAGCTGG + Intronic
903796653 1:25934050-25934072 TGCCCTGTTGGAAGACAAACAGG + Intergenic
904029360 1:27524279-27524301 TGACCCAGTGGCAGACAAGCTGG + Intergenic
904767984 1:32864850-32864872 AGCACTAGTGGGAAAGAAGCAGG - Intronic
910242180 1:85099226-85099248 TGCCCTTGAGGAAAACATGTGGG - Intronic
910644723 1:89501317-89501339 TGCACTAGAGTATAACAAGCTGG + Intergenic
915883392 1:159697558-159697580 TCGCCTAGAGGAGAACAAGCTGG + Intergenic
917042586 1:170822455-170822477 ATCTCTAGTGGAAAGCAAGCAGG + Intergenic
920529781 1:206693490-206693512 TTCCCTACTGGGAAATAAGCAGG - Intronic
922044232 1:221928182-221928204 TGATCTAGTGAAACACAAGCTGG + Intergenic
1062917294 10:1250824-1250846 AGCCCTAGTGTACATCAAGCAGG + Intronic
1064940049 10:20724139-20724161 TGCTCTAGTAGAAAGCCAGCCGG + Intergenic
1066079361 10:31914708-31914730 TGCCATAATGGAAAACAATATGG + Intronic
1069596988 10:69678559-69678581 AGCCCTGGTGGCAAAGAAGCTGG + Intergenic
1071083055 10:81835960-81835982 TGCCCTGGTGTAAGACAATCAGG + Intergenic
1072203630 10:93182849-93182871 TGCCCTAGTGCAAAGGATGCTGG + Intergenic
1072733997 10:97867019-97867041 TGTTCTAGTGGAAGAGAAGCCGG + Exonic
1072945492 10:99806326-99806348 TGCTCTAGTGAAAGACTAGCAGG - Intronic
1076469674 10:130709811-130709833 TGCCCTATAGGAAAACAGGGTGG + Intergenic
1077511095 11:2963520-2963542 TTCCATAGTGGAAAACAGACAGG + Intronic
1078363333 11:10687166-10687188 TGCCCTAGTGAGAGACAGGCAGG - Intronic
1081721796 11:45294725-45294747 TGCGCTAGTGGCAGGCAAGCTGG + Intergenic
1084297361 11:68221700-68221722 TGCCCTAGAGGAAAACCATCTGG - Intergenic
1084402048 11:68950261-68950283 TGCCTAACTGGAAAACCAGCAGG - Intergenic
1084758855 11:71255665-71255687 TGCTGTAGTGGAAAACAAGTAGG - Intergenic
1085226983 11:74930535-74930557 TTTCATAGTGGAAAAAAAGCAGG - Intronic
1085549728 11:77357590-77357612 TGCTATGGTGGAAAACAACCTGG + Intronic
1090601147 11:128372821-128372843 CACCCTAGTGAAAACCAAGCTGG - Intergenic
1092497559 12:9012118-9012140 TGACCTAGTGAAACACCAGCTGG + Intergenic
1093644120 12:21563877-21563899 TACACTTGTGGAAAACAAGATGG - Intronic
1094234761 12:28151052-28151074 TGCCCTTGTTGAAAATAAGTTGG + Intronic
1094419719 12:30257784-30257806 TGACCTAGTGAAACACCAGCGGG + Intergenic
1095640658 12:44481873-44481895 TGACCTAGTGAGATACAAGCTGG - Intergenic
1095934279 12:47659799-47659821 TGCCCTAGGGGAAAAAAATCTGG + Intergenic
1098046632 12:66407841-66407863 TGACCTAGTGAGAAACCAGCTGG + Intronic
1099529317 12:83756936-83756958 TGCCCTTGTTGAAAACCAGAGGG - Intergenic
1099839970 12:87953133-87953155 TGCCCTTGTTGAAATCATGCTGG - Intergenic
1104555560 12:129797005-129797027 TGTCCCTGTAGAAAACAAGCCGG - Intronic
1107956691 13:45520836-45520858 TACCCTTGTGAAAAACAAGCTGG + Intronic
1120099250 14:80425168-80425190 TGACTTTTTGGAAAACAAGCTGG + Intergenic
1122197122 14:100096641-100096663 TGCCCTGGAGGAAAAGATGCTGG - Intronic
1122434330 14:101683914-101683936 TGTCATAGTGGAAAAAAAGAAGG + Intergenic
1123404417 15:20011429-20011451 TAACCCAGAGGAAAACAAGCAGG - Intergenic
1123513750 15:21018076-21018098 TAACCCAGAGGAAAACAAGCAGG - Intergenic
1123914529 15:25009042-25009064 TTCACTACTGTAAAACAAGCTGG - Intergenic
1125535087 15:40437912-40437934 TGCCCTAGAGTAAAACATCCAGG - Intergenic
1133183874 16:4081198-4081220 TGCTCTCGTGGAACACAAACTGG + Intronic
1134198743 16:12180348-12180370 TGACCTACTGCAAAACAAGCTGG - Intronic
1137670399 16:50275078-50275100 TGCCCTGGGGAAAAGCAAGCAGG - Intronic
1138308956 16:56006892-56006914 TGCCCTAGAGGAAGAAAAGCTGG + Intergenic
1138652208 16:58467013-58467035 TCCCCCATTGGATAACAAGCAGG + Intronic
1139681887 16:68571512-68571534 TGCCCTGAGGGAAACCAAGCAGG - Intronic
1140030558 16:71334911-71334933 TGGCCTGGTGGAAGGCAAGCTGG - Intergenic
1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG + Exonic
1141625595 16:85259509-85259531 TGCCCTGGGGCAAAACAAGCCGG - Intergenic
1146627447 17:34445237-34445259 TTTCCTCGTGGAAAACATGCGGG + Intergenic
1148649020 17:49236311-49236333 TGCCCTAGGGGAAAGGAAGGAGG + Intergenic
1151665384 17:75542635-75542657 GGCCCTAGTGGAGAATAATCAGG - Intronic
1155682888 18:28511525-28511547 AGCCATACTGGAATACAAGCTGG - Intergenic
1157070320 18:44399994-44400016 TGAGCTAGTGGAAATAAAGCTGG - Intergenic
1158890844 18:61870583-61870605 TGCCCTGGTGGAAAACCTACAGG - Intronic
1159879154 18:73841854-73841876 TCCCCTAGTGGTGAACAATCAGG + Intergenic
1160222596 18:76988327-76988349 TTCCCCAGTGGAAGACAAGGCGG + Intronic
1161459740 19:4389615-4389637 CGCCCTAGAGGAAGAGAAGCAGG - Intronic
1161716048 19:5876872-5876894 TGCCCTTGTGGAACCCAAGGAGG + Intronic
1162134290 19:8545649-8545671 TGACCTCATCGAAAACAAGCTGG - Exonic
1164796760 19:31039901-31039923 AGCTGTAGTGGAAAACAAGATGG + Intergenic
1164804001 19:31102200-31102222 TGCACTTTTGGAAAACACGCAGG - Intergenic
1165122785 19:33572620-33572642 TGCCCCAGTGGAAAACAGTTTGG + Intergenic
1165899320 19:39161510-39161532 TGGCCCAGTGGAAATCAAGGGGG - Intronic
1166818019 19:45558491-45558513 GGCGCTAGGGGAAAACAGGCTGG - Intronic
925342174 2:3145407-3145429 TGACCTAGCGGAGAACACGCAGG - Intergenic
926404742 2:12539774-12539796 GTACCTAATGGAAAACAAGCGGG - Intergenic
927221979 2:20720842-20720864 TGCCTTTGTTGAAAACAAGTTGG - Intronic
930503478 2:52253807-52253829 TGCCCTGGAGGAACACAAGTAGG - Intergenic
932939895 2:76151734-76151756 TGCCATTGTGTAAAACAGGCTGG + Intergenic
933497528 2:83068190-83068212 TGAGCTAGTGGAAAAAAAACTGG - Intergenic
934984701 2:98875957-98875979 TGACCAAGAGGAAAGCAAGCAGG - Intronic
935278783 2:101499338-101499360 TGGTCTATGGGAAAACAAGCAGG - Intergenic
938715994 2:134022380-134022402 TGCCCTTGTGGCAAGAAAGCAGG + Intergenic
943907604 2:193519172-193519194 TGACCTAGAAGAAAAAAAGCTGG - Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947682114 2:232044344-232044366 TGCCCATGTGGAATACAAGGAGG + Intronic
948578916 2:238971070-238971092 GGCCCTTGTGGATAACTAGCGGG - Intergenic
1181532411 22:23524254-23524276 TGCCCAACTGTAAAACAAGAAGG - Intergenic
1181894587 22:26095870-26095892 TCCCATGCTGGAAAACAAGCAGG + Intergenic
949490806 3:4587098-4587120 TGCCTTAATGCAAAGCAAGCCGG - Intronic
949718530 3:6961730-6961752 TGCCCTAGTTAAGAACAAGGAGG - Intronic
949829341 3:8197333-8197355 TGACCTAGTGAAACACCAGCTGG - Intergenic
951994984 3:28717598-28717620 TGCCCTAGTGGCAAAGGAGAAGG + Intergenic
955109994 3:55939380-55939402 TGCCCTAGTGGGAAAGAAAAGGG + Intronic
956141950 3:66155102-66155124 TGCCCTTGTGGAATTCTAGCAGG - Intronic
956331840 3:68118946-68118968 TGCCCCTGTGGAAAACAATATGG - Intronic
959167799 3:102802468-102802490 TGCAGTAGCAGAAAACAAGCAGG - Intergenic
959632544 3:108524123-108524145 TGCCTTTTTGGAAAACAATCTGG - Intronic
959734082 3:109637763-109637785 AGCCCTTGTGGAAAACAGGGTGG - Intergenic
962078780 3:132114890-132114912 TGACCTAGTGAAACACCAGCTGG - Intronic
963766633 3:149343178-149343200 TCCCCCAGTGGGAAACCAGCAGG + Intergenic
964929699 3:162002090-162002112 TGGCTCAGTGCAAAACAAGCAGG - Intergenic
969944475 4:10769152-10769174 TGCCTTCATGGAAAACAACCTGG + Intergenic
970035454 4:11729972-11729994 TGCCTTTGTGGAAGACAAGATGG + Intergenic
972278851 4:37584424-37584446 TGCCCTAATGGGAGGCAAGCCGG + Intronic
974739004 4:65980173-65980195 TGGCCTTGTGGAAAACCAGATGG + Intergenic
975571179 4:75819293-75819315 AGCACTTGTGGAAAATAAGCAGG - Intergenic
980502461 4:133673928-133673950 TGCTTTGGTGGAAAGCAAGCTGG + Intergenic
981766101 4:148251772-148251794 TGCCTTAGTGGAAAAGAAATTGG - Intronic
984251041 4:177335141-177335163 TTGCCTAGTGCAAAACAAGGGGG + Intronic
987823040 5:22991008-22991030 TGACCTAGTGAGACACAAGCTGG + Intergenic
991203033 5:64016431-64016453 AGCCCTAGGGGAAAACAAGATGG - Intergenic
992728256 5:79631222-79631244 TGCCCTAGTTGAAAACCATTGGG + Intronic
992950075 5:81850132-81850154 TGCCCTTGTGCCAACCAAGCTGG + Intergenic
994159449 5:96539871-96539893 TGCCCAAATAGAAAACAAGGTGG - Intronic
994377768 5:99034607-99034629 TGCTATATTGTAAAACAAGCAGG + Intergenic
995346490 5:111125822-111125844 TGCCCCAGAAGAAGACAAGCTGG - Intronic
995869917 5:116734005-116734027 TGCCCTAGAGGAAGACATGCTGG - Intergenic
997629561 5:135356549-135356571 TGCCTTAAAGGAAAGCAAGCAGG - Intronic
1004748552 6:18537342-18537364 TGCCTCAGTGGAATACAAGTTGG + Intergenic
1005156878 6:22817712-22817734 TGACCTAGTGAGACACAAGCTGG + Intergenic
1005178931 6:23081187-23081209 TGCCCTAGTTGAATACACCCTGG + Intergenic
1014680605 6:124425057-124425079 TGCCCTGGTTGAAAATTAGCTGG - Intronic
1015081782 6:129235122-129235144 TGCCCATGTGAAAGACAAGCAGG + Intronic
1015993072 6:138968499-138968521 TGGCATAGTGGAAAAAAACCAGG - Intronic
1016352032 6:143178390-143178412 TTCCATAGAGGAAATCAAGCTGG - Intronic
1017457458 6:154614664-154614686 TTCCCTTCTTGAAAACAAGCTGG - Intergenic
1024405089 7:48969907-48969929 TTCCCTGGTGTAAAACAAGGAGG - Intergenic
1031142290 7:117956631-117956653 TGCCCAAGTGGAAAGAATGCAGG + Intergenic
1031497590 7:122469793-122469815 TGATCTAGTGGAACAGAAGCAGG + Intronic
1032785771 7:135198148-135198170 TGCCCTAGAGGAAAAGAAGCTGG + Exonic
1033609359 7:142951169-142951191 TGCCCTAGTGGAAAAGATAATGG + Intronic
1033800770 7:144899293-144899315 TGCCCAAGTGTGAATCAAGCAGG - Intergenic
1035084612 7:156247416-156247438 TGACCTACTGAGAAACAAGCTGG - Intergenic
1039021246 8:33209171-33209193 TGCAATAGTGGAACAGAAGCAGG + Intergenic
1039088350 8:33802225-33802247 TGCACTAGTGGACTTCAAGCTGG - Intergenic
1039531936 8:38270096-38270118 TGCCCTAGTGGAACACCCCCAGG + Exonic
1040863164 8:52021944-52021966 TGCCCTAGTGGAAAAAAAAAAGG - Intergenic
1041029426 8:53721002-53721024 TCCTGTTGTGGAAAACAAGCTGG + Intronic
1042377554 8:68071808-68071830 TGCCCTAGTGGAAAACAAGCAGG - Intronic
1044089263 8:87978974-87978996 TGCCTAAGTGGAAAACAAGGAGG - Intergenic
1045637322 8:104207440-104207462 TTCCCTGGTTGAAAAGAAGCAGG - Intronic
1047028312 8:120848895-120848917 TGCTATAGTGGAAAGAAAGCAGG + Intergenic
1047217681 8:122890241-122890263 TGCCTTTGTCGAAAATAAGCTGG + Intronic
1047342897 8:123999885-123999907 TGCCCTAGTGAGACATAAGCTGG - Intronic
1055916307 9:81404043-81404065 AGCCCTATGGGAAAACAAGCTGG - Intergenic
1056542467 9:87584525-87584547 AGCCATAATGGAAAACAATCTGG - Intronic
1061868411 9:133507216-133507238 TGCACCACTGGAAAACCAGCTGG + Intergenic
1186202948 X:7172346-7172368 TGCTCAAGCGGAAAACAGGCAGG - Intergenic
1186457343 X:9720378-9720400 TGTCCTAGTGCGGAACAAGCAGG - Intergenic
1187933632 X:24315360-24315382 TTCCCTAGAGGCAAAGAAGCTGG + Intergenic
1188716507 X:33465156-33465178 TGACCTAGTGAGACACAAGCTGG - Intergenic
1195521592 X:105836550-105836572 TACCCTCATGGAAAACAATCTGG + Intronic
1197117421 X:122850153-122850175 TGCCCTAGTGGAAAATGAAAGGG + Intergenic
1197635437 X:128909852-128909874 TGCCCTATTTGTAAACCAGCAGG + Intergenic
1199453504 X:147999787-147999809 AGCATTAGTAGAAAACAAGCAGG + Intronic