ID: 1042380872

View in Genome Browser
Species Human (GRCh38)
Location 8:68112708-68112730
Sequence TCTAACTTGCACACTCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042380872_1042380878 12 Left 1042380872 8:68112708-68112730 CCCTCCAGAGTGTGCAAGTTAGA 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1042380878 8:68112743-68112765 AAATCCTGCTTAATTTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042380872 Original CRISPR TCTAACTTGCACACTCTGGA GGG (reversed) Intronic
908608049 1:65822531-65822553 TCTAACATGCAAATTTTGGAGGG - Intronic
910077330 1:83296907-83296929 TATAAATGGCACTCTCTGGATGG - Intergenic
914360695 1:146933315-146933337 TCTAATTTGAAGTCTCTGGACGG + Intergenic
914491889 1:148157324-148157346 TCTAATTTGAAGTCTCTGGACGG - Intergenic
915127754 1:153678127-153678149 GCTAATCTGCACAGTCTGGAAGG + Intergenic
915814242 1:158949969-158949991 TATAACTTACACACAGTGGAAGG + Intronic
917969525 1:180197917-180197939 TCTAACTTCTGCACACTGGAAGG - Exonic
922176817 1:223203406-223203428 TCTAACTTGCTCCATCTGGTGGG + Intergenic
922429654 1:225538083-225538105 TCTGATTTGCATTCTCTGGAAGG + Intronic
923217973 1:231867569-231867591 CCTGTCTTGCACACTCAGGAGGG - Intronic
924053890 1:240105363-240105385 TGTAACTCCCACACTCTGGGAGG - Intronic
1070987072 10:80698254-80698276 TCTACATTGCACAGTCTGGCAGG - Intergenic
1071617369 10:87087524-87087546 TCTAACTAGGACACTCTTAATGG - Intronic
1081415659 11:42812015-42812037 TCTAACTTGTAAACTCTGGAAGG + Intergenic
1087150404 11:94854671-94854693 TTTAACATCCACCCTCTGGATGG - Intronic
1087166186 11:95005597-95005619 TCAAAATTGCTCACTCTGGCTGG - Intergenic
1089962039 11:122624943-122624965 TCTAAATTTCACCCTCTGTATGG + Intergenic
1096553782 12:52390950-52390972 CCTCACTGGCACATTCTGGAGGG + Intergenic
1101886572 12:108668697-108668719 TCCAACTCCCAGACTCTGGAAGG + Intronic
1102786176 12:115606782-115606804 TCTAACTTTCAGACTAGGGAGGG - Intergenic
1104485777 12:129150232-129150254 TCCACCCAGCACACTCTGGATGG - Intronic
1108328626 13:49361094-49361116 TCTAGCTAGCTCACTCTGCAGGG - Intronic
1109441504 13:62380037-62380059 CCAAACTTCCACAGTCTGGAAGG - Intergenic
1113873479 13:113579407-113579429 CCTAGCTTTCCCACTCTGGATGG - Intergenic
1114789189 14:25637015-25637037 TTTAACTGGCACACTATGAAAGG - Intergenic
1123204709 14:106701163-106701185 TATAACTTACACACACTGGGAGG - Intergenic
1123209711 14:106747603-106747625 TATAACTTACACACACTGGGAGG - Intergenic
1124877250 15:33606683-33606705 TCTCACTTTCCCTCTCTGGATGG + Intronic
1125347953 15:38738832-38738854 TAAAATTTGCTCACTCTGGATGG + Intergenic
1127621722 15:60740563-60740585 TCTGGCATGCACACTCTCGAAGG - Intronic
1128594856 15:68934990-68935012 TCTATCTTTCTCACTCTGAATGG + Intronic
1135357394 16:21780998-21781020 TTTAACTTGTAGACTCCGGAGGG + Intergenic
1135455898 16:22597114-22597136 TTTAACTTGTAGACTCCGGAGGG + Intergenic
1137405321 16:48184559-48184581 TCTATCTTCCACACGATGGATGG - Exonic
1137527573 16:49249771-49249793 TCTTACTTGCAGATTCTGGAAGG - Intergenic
1139583404 16:67886086-67886108 AATAACTTGCACACTCTGTGCGG + Exonic
1139691049 16:68642393-68642415 TCTACCCTCCACACTCTGGATGG + Intronic
1143787268 17:9265333-9265355 GCTAACAAGAACACTCTGGATGG + Intronic
1144567761 17:16374083-16374105 TCTGACTTGCCCAGGCTGGAGGG - Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1150437733 17:65167138-65167160 TCTCCCTTTCCCACTCTGGATGG - Intronic
1153682541 18:7514168-7514190 TCTTACCTGCACACTCTTGGTGG - Intergenic
1154329383 18:13417208-13417230 TCTAACTTTCAGACTTTGGCTGG - Intronic
1154963106 18:21329549-21329571 TCTTCCTTGGACACTCTGGGTGG - Intronic
925344555 2:3161481-3161503 TCTAATTTTCACACTTTGGGAGG + Intergenic
936487710 2:112940734-112940756 TTTAGCTTGCAAACTCTTGATGG + Intergenic
936763986 2:115822189-115822211 TGTAAGTTGCACAGTCTGAATGG - Intronic
941483515 2:166048352-166048374 CCCACCTTGCACACTCTGGTAGG + Intronic
942014806 2:171802260-171802282 TGTAACCTCCACACTTTGGAAGG - Intronic
944873685 2:203939828-203939850 TCTAACAAGAACACTCTGGAAGG - Intronic
945092724 2:206190948-206190970 TCTAACTTGTATAATCTGTATGG + Intronic
949080326 2:242092057-242092079 GCTAAATTGCACACTTTTGAGGG + Intergenic
1168856326 20:1011738-1011760 TCTAAATGTCCCACTCTGGAGGG + Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1172470366 20:35189277-35189299 TCTAAAATGGCCACTCTGGAGGG + Intergenic
1172890218 20:38259033-38259055 CCTAACTTGCACTTTCTGGGTGG + Intronic
1174826901 20:53776705-53776727 TGTAATTTCCACACTCTGGGAGG + Intergenic
1180157074 21:45982975-45982997 TCAAACCAGCTCACTCTGGAAGG - Intronic
950769786 3:15302213-15302235 TCCAACGTGGACACTTTGGAGGG + Intronic
952123111 3:30267939-30267961 TATAACTGCCACACTCTGTATGG + Intergenic
958088646 3:88847270-88847292 TCTAACCTTCACACTCTGAAAGG + Intergenic
958438507 3:94127343-94127365 TCTTACATTCACAATCTGGAGGG + Exonic
960005293 3:112775426-112775448 TCTGACCTCCACACTCTAGAAGG + Intronic
960241580 3:115348579-115348601 TCTAACTTCCTCTGTCTGGAGGG - Intergenic
960348269 3:116561765-116561787 TCCAACTTGAACTCCCTGGATGG + Intronic
960362498 3:116730804-116730826 TCTAACATGCACACACTTTAGGG - Intronic
963392985 3:144692654-144692676 GCTAAGTAGCACAGTCTGGATGG - Intergenic
965437897 3:168675087-168675109 TCTAATTTGCATACATTGGATGG + Intergenic
969351353 4:6599815-6599837 TCCAACCTGCAGGCTCTGGAAGG + Intronic
971140729 4:23922143-23922165 TCTGCCTAGCACTCTCTGGAAGG - Intergenic
975766705 4:77676187-77676209 CCTAACCTGCACAGTCTGGGGGG - Intergenic
980501511 4:133660902-133660924 TCTATTTTGCACACCCTGTAAGG - Intergenic
982484659 4:155953015-155953037 TCTAGCATGAAAACTCTGGAAGG - Intronic
983177052 4:164602334-164602356 TCTAATATGCACAATCTGTAAGG + Intergenic
986188393 5:5467616-5467638 TCTAGCTTGTATACTCTGTAAGG + Intronic
990503038 5:56415996-56416018 TTTAACTGGCACACTGTGGGAGG + Intergenic
990956073 5:61340755-61340777 TGTAACTTGAACTCTTTGGAGGG + Intronic
994038201 5:95226600-95226622 TTTAACTTGCCAACTATGGAGGG + Intronic
996352389 5:122559702-122559724 GCTAACTTCCAAACTCTGTAAGG - Intergenic
1002590075 5:180284735-180284757 TCTAAAATGCACACTGTGGATGG + Intronic
1007196610 6:40066868-40066890 TCTGACTAGGACACTGTGGAGGG + Intergenic
1007470667 6:42088313-42088335 TGTCACTTGCACTCTCAGGAGGG - Intergenic
1008521947 6:52370244-52370266 TCTAACTCGGACACTTGGGAGGG + Intronic
1018007281 6:159634198-159634220 TCCAACCTGCCCACTCTGTAAGG - Intergenic
1018795960 6:167185890-167185912 TCTAACATCCACCCTCAGGAAGG - Intronic
1018820358 6:167369174-167369196 TCTAACATCCACCCTCAGGAAGG + Intronic
1021563168 7:21988957-21988979 CCCAAATTGCACTCTCTGGAGGG + Intergenic
1022043618 7:26604223-26604245 TTTAAATGGAACACTCTGGAAGG + Intergenic
1024134273 7:46390584-46390606 TCTTCCTTGCACACTGAGGAGGG - Intergenic
1027295104 7:76762120-76762142 TATAAATGGCACTCTCTGGATGG - Intergenic
1030050515 7:105532918-105532940 TCTATATTGCAGACCCTGGAAGG - Intronic
1031273950 7:119693939-119693961 TGATACTTACACACTCTGGAAGG + Intergenic
1035278734 7:157764118-157764140 CGTAACTGGCACACTCTGCAGGG + Intronic
1035538370 8:410302-410324 GCTAAATTGCACACTTTTGAGGG + Intronic
1037426869 8:18765668-18765690 TGTAACTTCCACACTTTGGGAGG + Intronic
1040291034 8:46124675-46124697 TCTATCCAGCACACTCTGGGAGG - Intergenic
1042380872 8:68112708-68112730 TCTAACTTGCACACTCTGGAGGG - Intronic
1043723850 8:83583746-83583768 TCCAACTTTCACAATCTAGAGGG + Intergenic
1047215101 8:122869717-122869739 TCCAAAGTGCACACTCTCGATGG - Intronic
1047325286 8:123830020-123830042 TTGAACCTGCACAATCTGGAGGG - Intergenic
1049188013 8:141269197-141269219 TCTAACTGGGACACTCTTGAGGG - Intronic
1049264491 8:141660195-141660217 CCTAACTTGGACAATCTGGCTGG + Intergenic
1051214195 9:14778784-14778806 TATAGCTTGGACACTCTGGGAGG + Intronic
1051621158 9:19050402-19050424 CCTAACTTCCATGCTCTGGAAGG - Exonic
1052181118 9:25529601-25529623 GCTAAATTGCCCAATCTGGAAGG - Intergenic
1053588353 9:39483997-39484019 TCTATCTTGCAGTCTCTGGGAGG - Intergenic
1054116780 9:61171340-61171362 CAAAACTTCCACACTCTGGAAGG + Intergenic
1054577952 9:66881297-66881319 TCTATCTTGCAGTCTCTGGGAGG + Intronic
1057835705 9:98443345-98443367 TCAAACTTGCAAGCTTTGGAAGG + Intronic
1058260628 9:102825609-102825631 TTTAAATTGCACTCTTTGGAAGG - Intergenic
1058491174 9:105501252-105501274 TATAACTACCATACTCTGGAGGG - Intronic
1192038289 X:67589402-67589424 ACTAACATACACACTCTGTAAGG - Intronic
1194163220 X:90481788-90481810 TCTAACTTGCTCACTTTAGGAGG - Intergenic
1197334282 X:125193123-125193145 TCTAACTTCCTCTCTCTTGAAGG + Intergenic
1199040408 X:143108845-143108867 TAGAAGTTGCAAACTCTGGAAGG - Intergenic
1200509493 Y:4059514-4059536 TCTAACTTGCTCACTTTAGGAGG - Intergenic