ID: 1042386128

View in Genome Browser
Species Human (GRCh38)
Location 8:68177014-68177036
Sequence CTTTGGGCTAAATCCAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 3, 1: 0, 2: 1, 3: 5, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042386128_1042386134 25 Left 1042386128 8:68177014-68177036 CCAGTCCTGGATTTAGCCCAAAG 0: 3
1: 0
2: 1
3: 5
4: 113
Right 1042386134 8:68177062-68177084 GCTGAGAACAATGATACAAAAGG 0: 1
1: 0
2: 0
3: 17
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042386128 Original CRISPR CTTTGGGCTAAATCCAGGAC TGG (reversed) Intronic
900299550 1:1969930-1969952 CTTCGGGCAAAACCCAGGACAGG + Intronic
903970749 1:27117337-27117359 CTTGGTGCTAACGCCAGGACAGG - Intronic
908335245 1:63116099-63116121 CTTTTGGCTAAGTCAAGGATAGG + Intergenic
913340976 1:117757964-117757986 CTTTGGGGGAAAGCCAGGAAAGG + Intergenic
913997997 1:143667233-143667255 CTTTGGGCTGTATTGAGGACAGG + Intergenic
914508412 1:148309183-148309205 CTTTGGGCTGTATTGAGGACAGG + Intergenic
914777112 1:150747492-150747514 TTTTGGGCTAAATAGAGGAGAGG + Intronic
916557317 1:165904299-165904321 CTTTGGTTTAAATGCGGGACAGG + Intronic
916723070 1:167499560-167499582 CTTTGGGTTAAAATCAGGAATGG + Intronic
919509583 1:198445111-198445133 CTTTGGGGTAAAAACAGGAAGGG + Intergenic
924182120 1:241449299-241449321 GCTTGAGCTAAAACCAGGACTGG - Intergenic
1063010679 10:2019471-2019493 CCTTGGGCAAAATCCAGAGCTGG + Intergenic
1073919869 10:108446279-108446301 CTGTGGGCCAAATTCAGGTCAGG + Intergenic
1074274219 10:111985955-111985977 CTCTGGGCCAGATACAGGACTGG + Intergenic
1074436289 10:113437084-113437106 TTTTAGGTTAACTCCAGGACTGG - Intergenic
1075320185 10:121485244-121485266 CTCTGGGCTCAATCCAGAGCTGG - Intronic
1078433144 11:11302953-11302975 CTTTGTCCTATATCCAGGAGAGG - Intronic
1079193200 11:18299602-18299624 CTTTGGGTTAAAACCAGAAGTGG - Intronic
1081020038 11:37934697-37934719 CCTTGGGCTAAAATCAGGAAAGG - Intergenic
1081853389 11:46289398-46289420 CTTTCGGGTAGATCAAGGACAGG - Intronic
1082033109 11:47621388-47621410 CTGTGGGCTAAATTTAGCACAGG - Intronic
1090446440 11:126768643-126768665 CTTTGGGCTAAGACCTGCACAGG + Intronic
1090866547 11:130705729-130705751 CCTGGGGCTGAATCCAGGACGGG + Intronic
1092043545 12:5407136-5407158 CTGTGGGTCAAATCCAGCACAGG - Intergenic
1094357804 12:29596899-29596921 CTTTTGTCTAAAGCCATGACTGG - Intronic
1100160305 12:91852463-91852485 CTTTTGGGTATATCTAGGACTGG - Intergenic
1100810781 12:98335903-98335925 CTGAGGGCTAAATCCAGGTTGGG - Intergenic
1102146793 12:110660386-110660408 CAGTGGGCTAAGGCCAGGACAGG + Intronic
1102359030 12:112267598-112267620 CTTGGGGCTAGATGCAGAACTGG + Intronic
1104416845 12:128602719-128602741 CATTGGCCTAATTCCAGGATGGG - Intronic
1111789947 13:92842180-92842202 AGTTGGGCAAAATCCAGTACTGG - Intronic
1111808441 13:93067382-93067404 CTTTAGTCTCAGTCCAGGACTGG + Intergenic
1112165603 13:96916736-96916758 CTTTGGGTTAAAGCAGGGACAGG + Intergenic
1113771046 13:112909148-112909170 TTCTGGGTTAAGTCCAGGACTGG + Intronic
1118832356 14:69446376-69446398 CTCAGGGCTGATTCCAGGACAGG + Intronic
1119774680 14:77240835-77240857 CTCTGTGCTAAAGCAAGGACAGG - Intronic
1121575259 14:94979815-94979837 CTTTTGGATAAATCCTGAACTGG + Intergenic
1123951519 15:25282342-25282364 CTGTGGGCTCATTCCAGAACTGG - Intergenic
1126547402 15:49888193-49888215 CTCTGGGGAAAGTCCAGGACTGG - Intronic
1128911954 15:71523641-71523663 CTGTGGCCTTAGTCCAGGACTGG + Intronic
1129757323 15:78106236-78106258 CTGTGGGCTAAGGCCAGGAAGGG - Intronic
1129896200 15:79107821-79107843 CATAGGGCTGAATCCAGGAGTGG + Intergenic
1130212747 15:81940590-81940612 CTTTGGGGGAAATCCAAGCCTGG + Intergenic
1134668396 16:16036658-16036680 CTGTGGCCTCAATCCAGGATGGG + Intronic
1135189288 16:20341744-20341766 CTTTGGTCTCAATCTAGAACAGG + Intronic
1137267279 16:46879708-46879730 CTTTGGGAAAAATCCAGATCAGG - Intergenic
1137558643 16:49489183-49489205 GTTTGGGATAAATCCAGAGCTGG + Exonic
1138371782 16:56532811-56532833 CTTTGATCTGAACCCAGGACAGG - Intergenic
1139654958 16:68381969-68381991 CTTTGTCCTGAATCCAGGCCAGG + Intronic
1144273371 17:13641602-13641624 GTGTGGGCTCAATTCAGGACAGG + Intergenic
1153853422 18:9119531-9119553 CTTTGGGCTAAATCCAGGACTGG - Exonic
1160504977 18:79421944-79421966 GTTTTGGCAACATCCAGGACAGG + Intronic
1166223142 19:41378285-41378307 CTTTGGGGAAACTCCAGGAGGGG - Exonic
1167512244 19:49901547-49901569 CTTTGGCCTGACCCCAGGACAGG + Intronic
1167975710 19:53224458-53224480 CTTTGGGCTAAATCCAGGACTGG + Intergenic
927009809 2:18891457-18891479 CTTTGGTCTAAGTCAAGCACTGG - Intergenic
928671711 2:33609815-33609837 GTTTGGCCTACATCCAGGAATGG - Intergenic
929593284 2:43160525-43160547 ATCTGGGCTAAAACTAGGACAGG + Intergenic
929864322 2:45705355-45705377 CTTTGGGCTGAATCCAGGAGTGG + Intronic
931702850 2:64923104-64923126 CTTTGAGATAAAGACAGGACTGG - Intergenic
935142941 2:100370416-100370438 CTTTGGGCAGAATACAGGTCAGG - Intergenic
937411565 2:121681365-121681387 CTTGAGGGTAAATCTAGGACAGG + Intergenic
938790001 2:134668243-134668265 CTGTGGGCTTGTTCCAGGACAGG - Intronic
944806600 2:203287861-203287883 GTTTGTGCAAAAGCCAGGACAGG - Intronic
947944676 2:234091464-234091486 CTTTTGCCTAAATCCTAGACTGG + Intergenic
1172025953 20:31948737-31948759 CTTTGGTCTTAACCCAGAACAGG - Intronic
1172510585 20:35498095-35498117 CTTTGGGCCAAAGCCAGGCCTGG + Intronic
1173703292 20:45092182-45092204 GTTTGTGCCAAATCCAGGACTGG + Intergenic
1177308830 21:19359002-19359024 CTTTTGGCTAAACCCAGGTAAGG + Intergenic
1180653526 22:17399208-17399230 CTTGGAGCTAAAGCCAGGATGGG - Intronic
1181529639 22:23509917-23509939 ATCTGGGCTGATTCCAGGACTGG + Intergenic
1182973452 22:34599575-34599597 CTTTGGGCTGGCTCCAGGTCAGG - Intergenic
951082084 3:18464565-18464587 GTTTGGGGTAAATCCTGGAATGG - Intergenic
951826321 3:26873217-26873239 CTTTGAGATTAATCCAGGATAGG + Intergenic
955174016 3:56594746-56594768 CATTAGGCTAAAATCAGGACAGG - Intronic
963186978 3:142429441-142429463 ATTACGGCTAAATCCAGGCCGGG - Intronic
967323519 3:188217008-188217030 CTTTGCTCTAAATCGAGTACTGG - Intronic
972323020 4:37990244-37990266 CTGTGGGCTACATACAGGCCAGG + Intronic
972628252 4:40821309-40821331 CTTGGGGCTGAATCCAGGCTCGG + Intronic
974775057 4:66468842-66468864 ATTTGGACTCAGTCCAGGACAGG - Intergenic
979596347 4:122538714-122538736 CTTTGGGACAAATCCAGACCAGG - Intergenic
986021553 5:3809060-3809082 CTTTGGGCTGGAACCAGCACAGG + Intergenic
992204172 5:74414257-74414279 CTTTGGCCTTAAACCAGGATTGG - Intergenic
993251799 5:85536030-85536052 CTTTGTGCTAAATCCCTGACAGG - Intergenic
994728251 5:103461887-103461909 CTCTGGCCTAAAACCAGGGCAGG + Intergenic
996019660 5:118577537-118577559 CTTTAGGCTCAATCCTGGAGGGG - Intergenic
1000675128 5:164112431-164112453 GTTTGGGCCAACTGCAGGACTGG - Intergenic
1002690587 5:181047035-181047057 CTGTGGGCCAAGTGCAGGACAGG + Intronic
1003766829 6:9246388-9246410 CTTTGAGTTAAATGCAGGAAAGG + Intergenic
1008496714 6:52141451-52141473 ATTTGGGTAAAATCAAGGACAGG - Intergenic
1010744957 6:79550392-79550414 CTTAGGGAAAAATCCAGGAGTGG - Intergenic
1012494761 6:99821934-99821956 CTTTTGGCTACATCCCGGAGAGG + Intergenic
1012969326 6:105710650-105710672 CATTTGGCTCAATTCAGGACTGG - Intergenic
1014044643 6:116871559-116871581 ATTTGGGGAAAATCCAGGAAAGG - Intergenic
1016067530 6:139699560-139699582 GTTTGGGCTTAATCCAGAAATGG - Intergenic
1029225261 7:99022369-99022391 CTTTGGGCTACCTGAAGGACTGG + Intergenic
1030579824 7:111340598-111340620 CTTTGGTATAAATCTAGGAGTGG - Intronic
1036961851 8:13253095-13253117 ATTTGGGTTAACTCCTGGACTGG + Intronic
1037644689 8:20782648-20782670 CTTTGGACTAGGACCAGGACTGG - Intergenic
1040918129 8:52584949-52584971 CTTTGCTCTAAGTCCTGGACAGG + Intergenic
1042386128 8:68177014-68177036 CTTTGGGCTAAATCCAGGACTGG - Intronic
1046109721 8:109708125-109708147 CTTTCTGCTAAATCAACGACAGG - Intergenic
1046987745 8:120408453-120408475 ATTTGAGCAAAACCCAGGACTGG + Intronic
1047174146 8:122524529-122524551 CTTAGGGCTTAACCCAGAACTGG + Intergenic
1048197214 8:132341644-132341666 CTGTGGGCTTAATCCAGACCTGG + Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1051016443 9:12481321-12481343 CCTTGGTTAAAATCCAGGACAGG - Intergenic
1051761191 9:20466592-20466614 CTTTGGGCTAAATAGATAACAGG + Intronic
1055278086 9:74642209-74642231 CTGTGGGCATAAACCAGGACAGG + Intronic
1056568743 9:87797764-87797786 CTTCTGGCTGAATCAAGGACAGG - Intergenic
1058392766 9:104515246-104515268 CTTTGGGTTATATCCAGTAATGG - Intergenic
1058560232 9:106220758-106220780 CTTTGGGCAAAAGACAGGAGGGG - Intergenic
1059810130 9:117847301-117847323 CTTTGGGGTGATGCCAGGACAGG - Intergenic
1061254583 9:129447068-129447090 ATCTGGGCTGACTCCAGGACTGG - Intergenic
1062129178 9:134883485-134883507 CTTGGGGCTTAGTCCAGGGCAGG + Intronic
1186247739 X:7632004-7632026 CCTTGGGCAAAATCCATGGCAGG - Intergenic
1192908460 X:75578282-75578304 CCTTAGGCTAGATCCAGCACTGG - Intergenic
1194207548 X:91029882-91029904 CTTTGAACTGAGTCCAGGACTGG - Intergenic
1194975307 X:100390170-100390192 CTCTGGGCTGAATACAGGCCTGG + Intronic
1197483611 X:127019009-127019031 CCTTGCCCTAAATCCAAGACTGG - Intergenic
1199824795 X:151488368-151488390 CCTTGGGCTGAATCATGGACAGG + Intergenic
1200553345 Y:4604928-4604950 CTTTGAACTGAGTCCAGGACTGG - Intergenic