ID: 1042386304

View in Genome Browser
Species Human (GRCh38)
Location 8:68178855-68178877
Sequence TGATTGCAATACAACTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042386304 Original CRISPR TGATTGCAATACAACTTCAC TGG (reversed) Intronic
902766094 1:18616397-18616419 TGATAGAAATGCAACTTCTCAGG - Intergenic
904815146 1:33190528-33190550 TGTTTCCAGTACACCTTCACTGG - Intergenic
906972811 1:50534681-50534703 TGATTGATATACAACTTCACGGG + Intronic
907834351 1:58094855-58094877 TGATAGAAATACAACATCTCAGG - Intronic
911131886 1:94396924-94396946 TTCTTGAAATACAACATCACAGG - Intergenic
912171382 1:107104328-107104350 TGATTGCAGCACAGCTTCACTGG + Intergenic
914929248 1:151915760-151915782 TGATTCCAATGCAATTTCCCCGG - Intergenic
916560523 1:165930897-165930919 TGATTGAAATGCAGCGTCACCGG + Intergenic
917293045 1:173491279-173491301 TGAAAGAAATACAACTTCAGAGG + Intergenic
921663683 1:217839938-217839960 TTATTGCAGAGCAACTTCACTGG - Intronic
921781011 1:219163617-219163639 TGATCACAATACAACTTCACTGG + Intergenic
923731280 1:236553003-236553025 TGATTGTATTAGAACTTTACTGG - Intronic
1069233231 10:66038052-66038074 TGTCTGTAATACAACTCCACAGG + Intronic
1070114811 10:73518033-73518055 TGATTGGAATGCGACTTCACAGG - Intronic
1071823597 10:89302364-89302386 TGATTGCAACTCAACTCCCCAGG - Intronic
1072319756 10:94237606-94237628 GGATTTCAATATGACTTCACAGG - Intronic
1073737806 10:106369748-106369770 TCAGTGTAATATAACTTCACTGG + Intergenic
1074097868 10:110329952-110329974 TGAATGCAACAGACCTTCACTGG + Intergenic
1079409775 11:20176538-20176560 TGATAGCAAAACATCTTCAATGG - Intergenic
1085480444 11:76818854-76818876 AGATAGCAATACAAGCTCACTGG + Intergenic
1085985014 11:81776238-81776260 TGATTGCTAAACACCTTCCCTGG + Intergenic
1086527803 11:87749550-87749572 TGATTGCAACACAGCATCACAGG - Intergenic
1090535499 11:127636737-127636759 TTTTTGCAAGACAACCTCACTGG - Intergenic
1091122410 11:133066977-133066999 TTATCTCAACACAACTTCACCGG - Intronic
1093917207 12:24817831-24817853 TGATTGCAATTCATTTTCTCTGG + Exonic
1098025995 12:66202142-66202164 TGATTCTAATCCAACATCACAGG - Intronic
1098311358 12:69152254-69152276 TGACTGCATTAAAACATCACTGG - Intergenic
1098446130 12:70567756-70567778 TAATTCCAAAACACCTTCACAGG + Intronic
1099412103 12:82343780-82343802 TTTTTGCAATACAAATGCACAGG + Intronic
1100048468 12:90413531-90413553 TGATTCTAATCCAACATCACAGG + Intergenic
1100322699 12:93510975-93510997 GGATGGCAAAATAACTTCACTGG + Exonic
1105682053 13:22738370-22738392 TCATTTCAATAAAACTTCTCAGG + Intergenic
1109059039 13:57589764-57589786 CAATTGCAATACAAATTCAAAGG - Intergenic
1109378693 13:61528531-61528553 TGATTGTAAAACAACTGTACAGG + Intergenic
1109935328 13:69275936-69275958 TGATAGCAATACAACATTTCTGG - Intergenic
1111961963 13:94821626-94821648 TGCTTGCAAGACTACTTCATAGG + Intergenic
1113541599 13:111114252-111114274 TGATTGCAAGAGAAATCCACCGG + Intergenic
1114998010 14:28383025-28383047 TGAGTGCTATAGAACTTCAAAGG - Intergenic
1115512269 14:34149361-34149383 TGATTCCAATCCAGCTTCACAGG - Intronic
1115825358 14:37266040-37266062 TTATTGTAATAAAACTTCAAGGG + Intronic
1116131287 14:40857636-40857658 AGATAGCAATACAAGCTCACCGG - Intergenic
1132427088 15:101726733-101726755 GGCTGGCAATACACCTTCACAGG + Intergenic
1134139293 16:11703455-11703477 TGATTTCAATTTAACATCACAGG - Intronic
1135309382 16:21393372-21393394 TGCTAGAAATGCAACTTCACAGG - Intergenic
1136148959 16:28333685-28333707 TGCTAGAAATGCAACTTCACAGG - Intergenic
1137223075 16:46474621-46474643 TGATGGCTATACAACTTTCCTGG - Intergenic
1141074360 16:80989754-80989776 TAATTCCAATCCAACATCACAGG + Intronic
1141286121 16:82673760-82673782 TGATTGCTCCACAACTTTACAGG + Intronic
1150014354 17:61538821-61538843 TGCCTGCACTACAGCTTCACAGG + Intergenic
1150466241 17:65395188-65395210 AGCTTGCAAGACTACTTCACAGG + Intergenic
1156413590 18:36862147-36862169 TGATTACAGTACAATATCACAGG + Intronic
1156908819 18:42386413-42386435 TGATTGAAATACTACTACATTGG + Intergenic
1163343161 19:16722963-16722985 TGCTGGCCATACAACTTCACTGG + Intronic
1165680093 19:37766798-37766820 TTATTGCAAGACAACTTCCTGGG - Intronic
1168670193 19:58235758-58235780 TGATTAAAAAACAACTTCATAGG + Intronic
925234872 2:2269248-2269270 TGATCTCAATACAAATTCAAGGG - Intronic
929425215 2:41838177-41838199 TGATTGCAATATGGCTTCCCAGG - Intergenic
931963071 2:67503255-67503277 TCATTGCATCACAACTTCAGGGG + Intergenic
932995053 2:76841571-76841593 TAAATGCAATATAATTTCACTGG + Intronic
935079270 2:99776590-99776612 TGTTTGAAATATAATTTCACAGG - Intronic
936918902 2:117667912-117667934 TGACTGCAATATGACTTCTCAGG - Intergenic
937749769 2:125461283-125461305 AGATTTCAATCCAACTTGACAGG - Intergenic
938635408 2:133220252-133220274 TGATTGCCAAACAAATGCACAGG + Intronic
943800118 2:192046708-192046730 TGCTTGCATTACAGCTACACTGG - Intronic
944399425 2:199308368-199308390 TGGATGCAAAACTACTTCACAGG + Intronic
945366479 2:208960725-208960747 TGATTGCTTTATAACGTCACTGG - Intergenic
947483336 2:230523228-230523250 AGATAGCAATACAAATTCACTGG - Intronic
948110629 2:235452658-235452680 TGATTCCAATTCAACACCACAGG + Intergenic
1174789607 20:53465098-53465120 TGATTTCATTCCAGCTTCACTGG + Intronic
1177442402 21:21143421-21143443 TGATTACATTAAAAATTCACAGG - Intronic
1177879057 21:26670213-26670235 AGATAGCAATACAAACTCACCGG + Intergenic
950204260 3:11065924-11065946 AGATAGCAATACAAACTCACCGG - Intergenic
954961357 3:54567858-54567880 TGTTTTCCATACAACATCACTGG - Intronic
957526599 3:81386158-81386180 TGTTAACAATACAAATTCACCGG - Intergenic
957763529 3:84591005-84591027 TGATTGAAATACAACTATATTGG - Intergenic
957883408 3:86251492-86251514 TGTTTGCCATACATCTTCTCTGG - Intergenic
958092961 3:88901117-88901139 TGGTTTTAATACAACATCACTGG + Intergenic
959214119 3:103427798-103427820 TGATCACAATACAACTTCATAGG - Intergenic
959478088 3:106836944-106836966 AGATAGCAATACAAACTCACTGG + Intergenic
962202294 3:133411515-133411537 TGTTTGCAAGACTACTTCATAGG - Intronic
962625172 3:137219032-137219054 TGTTAGAAATACAACTTCTCAGG + Intergenic
963808162 3:149747401-149747423 TGATTCTCATTCAACTTCACAGG - Intronic
965611673 3:170550409-170550431 TGATTCAAATACTACTGCACAGG + Intronic
967515113 3:190359437-190359459 GGATTGCAATAAAGCTGCACTGG - Intronic
968754659 4:2409109-2409131 TGATGGCCATGCAACTCCACGGG - Intronic
970790070 4:19847082-19847104 TGCTTGCAATAAAACTTGCCAGG - Intergenic
974820209 4:67057912-67057934 TGATCGCAATAGAAATTCAGAGG - Intergenic
975511423 4:75197627-75197649 TGATTGCTATACAGTGTCACCGG + Intergenic
976547604 4:86355453-86355475 TGAGTGCAATAGAAATTCAGAGG - Intronic
976594412 4:86881266-86881288 TGATAACAATTCAACTTCAGTGG - Intronic
980214878 4:129839028-129839050 TGGTTGCTCTACATCTTCACAGG - Intergenic
981011308 4:139928120-139928142 TGATTCCAATCCAACATCACAGG + Intronic
981176675 4:141690526-141690548 TGATTGGAATAATACTTCATAGG - Intronic
982912207 4:161157823-161157845 TGATTTCAATACAAATTCATTGG + Intergenic
986526074 5:8677554-8677576 TGCTTGCAACAAAACTGCACTGG - Intergenic
988062839 5:26195611-26195633 TTATTGCAATGCAACTTTGCTGG + Intergenic
988261215 5:28887845-28887867 TAATTGAAATACAGTTTCACAGG - Intergenic
988670590 5:33376855-33376877 TGCTTGTAATACATATTCACTGG - Intergenic
988912302 5:35855672-35855694 TGATTGCCACACAACTTTTCAGG - Intronic
990240472 5:53811744-53811766 TGATGGAAATACAACCTCTCAGG - Intergenic
991937584 5:71817123-71817145 AGATTGCAATAAAGCTTAACGGG - Intergenic
993148484 5:84128182-84128204 TGGTTGCAATAAAACTTGACTGG - Intronic
994272761 5:97801787-97801809 TGATTGTAAGTCAACTTCTCAGG + Intergenic
994739508 5:103600370-103600392 TGATTGCAATAGGACTCCAATGG + Intergenic
1001192086 5:169640718-169640740 TCATTGCCATAAAACTTCCCTGG + Intronic
1004272403 6:14207525-14207547 TGACTGCAATAAAACTTGATAGG - Intergenic
1011748863 6:90435016-90435038 TTATTGCAGTTCAAGTTCACAGG - Intergenic
1013468355 6:110437450-110437472 TGAATGCAATAAAACTACTCGGG - Intronic
1018399561 6:163409217-163409239 TGATTGCAAGACAATTTCACAGG - Intergenic
1019164725 6:170090673-170090695 TGAATCCAATAGCACTTCACAGG - Intergenic
1019948172 7:4346889-4346911 TGATTTCAATTCAATGTCACAGG - Intergenic
1021003619 7:15365293-15365315 TGATATCAATCCAACTTTACGGG + Intronic
1023349401 7:39305176-39305198 TGATTTCATTTCATCTTCACAGG + Intronic
1023492227 7:40755721-40755743 TGACTGCAATGCACATTCACAGG - Intronic
1024552819 7:50577673-50577695 TGACTGCAATCCAAACTCACCGG - Intergenic
1026273684 7:68858421-68858443 TGACTCCAAAACATCTTCACAGG + Intergenic
1027995439 7:85420154-85420176 AGATTGCAATACAACTTTTCAGG + Intergenic
1030144005 7:106333744-106333766 AGATAGCAATACAAGCTCACTGG - Intergenic
1032768934 7:135028594-135028616 TGAGGGCTACACAACTTCACTGG - Intronic
1035609464 8:950289-950311 TGATTGTGATACAATTTGACAGG + Intergenic
1035896843 8:3412445-3412467 TGAATGCAATATAACATCTCTGG - Intronic
1040682492 8:49829786-49829808 AGATAGCAATACAAACTCACTGG - Intergenic
1041030149 8:53728542-53728564 TGCTCGCATTACAATTTCACTGG + Intronic
1042386304 8:68178855-68178877 TGATTGCAATACAACTTCACTGG - Intronic
1043587008 8:81781272-81781294 TCATTGCATTTCATCTTCACAGG + Intergenic
1044277572 8:90320443-90320465 TGATTTATATACAACTTTACAGG + Intergenic
1048566891 8:135609944-135609966 TGATTTCAGTAGATCTTCACAGG + Intronic
1050149843 9:2608592-2608614 TGATTGCAGTAGAATTTCAGTGG + Intergenic
1050478803 9:6068523-6068545 TGATTGCACTATAACTACACAGG - Intergenic
1050686651 9:8178109-8178131 TCAGTGCAATACAACTGCTCTGG - Intergenic
1055729357 9:79264757-79264779 TGATTGCAGTACAAATTCTCCGG - Intergenic
1057467560 9:95329632-95329654 TGAGTTAAATACAAATTCACTGG + Intergenic
1059859752 9:118446770-118446792 TATTTGTAATACAAATTCACTGG + Intergenic
1060533675 9:124365464-124365486 TGATTGCCAGAGAACCTCACAGG + Intronic
1185572302 X:1144443-1144465 TAATTGAAATACAATATCACAGG + Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1187976058 X:24706542-24706564 TGGTTGAAATCCAACATCACTGG + Intronic
1188303855 X:28538476-28538498 TGTTTGCAATTCAACTTTATGGG - Intergenic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1190150167 X:47939414-47939436 TGATTCCAATCCAACACCACAGG - Intronic
1194380026 X:93179859-93179881 AGATAGCAATACAAGCTCACTGG - Intergenic
1195883773 X:109619444-109619466 GGATTGCAGTACAAACTCACTGG - Intergenic
1196279410 X:113805282-113805304 TTATGGCAATATAATTTCACAGG + Intergenic
1197085248 X:122465671-122465693 CAAATGCAATACAACATCACTGG + Intergenic
1198284280 X:135174351-135174373 TGATTGAAAAAAAACATCACTGG + Intergenic
1198294671 X:135274066-135274088 AGATAGCAATACAAGCTCACTGG - Intronic