ID: 1042390889

View in Genome Browser
Species Human (GRCh38)
Location 8:68232173-68232195
Sequence GAGGGGAACCAGGATGAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 483}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042390886_1042390889 -9 Left 1042390886 8:68232159-68232181 CCCTGGGGATCAGGGAGGGGAAC 0: 1
1: 0
2: 3
3: 32
4: 325
Right 1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG 0: 1
1: 0
2: 1
3: 43
4: 483
1042390887_1042390889 -10 Left 1042390887 8:68232160-68232182 CCTGGGGATCAGGGAGGGGAACC 0: 1
1: 0
2: 3
3: 47
4: 329
Right 1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG 0: 1
1: 0
2: 1
3: 43
4: 483
1042390877_1042390889 10 Left 1042390877 8:68232140-68232162 CCTGGGGATCAGGGAAGTGCCCT 0: 1
1: 0
2: 1
3: 19
4: 212
Right 1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG 0: 1
1: 0
2: 1
3: 43
4: 483
1042390873_1042390889 20 Left 1042390873 8:68232130-68232152 CCATAATGGCCCTGGGGATCAGG 0: 1
1: 0
2: 0
3: 14
4: 148
Right 1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG 0: 1
1: 0
2: 1
3: 43
4: 483
1042390876_1042390889 11 Left 1042390876 8:68232139-68232161 CCCTGGGGATCAGGGAAGTGCCC 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG 0: 1
1: 0
2: 1
3: 43
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042390889 Original CRISPR GAGGGGAACCAGGATGAAGA AGG Exonic
900087150 1:904154-904176 GAGGGGGACAAGGATGCACAAGG + Intergenic
900666247 1:3817424-3817446 GAGAGGAACCAGGGAGAAGCAGG - Intronic
900762982 1:4485407-4485429 GAGAAGAACCAGACTGAAGAAGG + Intergenic
900792212 1:4688080-4688102 GTGGGGAGCCAGGATGGGGAAGG + Intronic
901264437 1:7899340-7899362 GAGCTGAAACAGGATAAAGATGG - Intergenic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
902279128 1:15361620-15361642 CAGGTGATCCAGGATGAATAGGG + Intronic
902468090 1:16630461-16630483 GAGTGGAACCAGGATGCAAGGGG - Intergenic
902506068 1:16939555-16939577 GAGTGGAACCAGGATGCAAGGGG + Intronic
903155049 1:21437214-21437236 GAGTGGAACCAGGATGCAAGGGG + Intergenic
904321558 1:29700966-29700988 GAGGGGTAGGAGGAAGAAGAGGG + Intergenic
904323386 1:29711136-29711158 GAGGGGAGAAAGGAGGAAGAGGG + Intergenic
904819805 1:33234631-33234653 GAGAGGAAGCAGGAGGAACAGGG + Intergenic
905173467 1:36122745-36122767 CTGGGGAACAAGGATGAAGGGGG - Intronic
906205256 1:43983221-43983243 TGGGAGCACCAGGATGAAGACGG + Intronic
909949594 1:81704100-81704122 GAGGGGAAGTATGATGATGAAGG - Intronic
910577488 1:88782181-88782203 GAGAGGAACAAAGATTAAGATGG - Intronic
912145164 1:106784754-106784776 GAGGTTAGCCAGGAAGAAGAAGG - Intergenic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
912872855 1:113326132-113326154 GAGGGAAACCAGAATGAAGCTGG - Intergenic
913148655 1:116017788-116017810 GAAGGGGACCAGGAAGAGGAAGG + Intronic
913414511 1:118590126-118590148 GATGGGAACCAGGATGGGGCAGG - Intergenic
914814965 1:151056576-151056598 GAGGGAAATCAGGAGGAATAGGG - Intronic
914873947 1:151498534-151498556 GAGAGGAAGCAGGATGGATAGGG + Intergenic
914990351 1:152494613-152494635 GAGGGGGACAAAGATGGAGATGG - Intergenic
915269888 1:154746517-154746539 GAGGAGAAGGAGGAAGAAGATGG - Intronic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
916423090 1:164654493-164654515 GAGGAGGAACAGGATCAAGAAGG + Intronic
916493780 1:165326705-165326727 GACAGGAAACAGGATGAAGAGGG - Intronic
916585133 1:166143639-166143661 ATGTGGAACCAGGAGGAAGAGGG + Intronic
916655124 1:166868514-166868536 GTGGGAGATCAGGATGAAGAAGG - Intronic
917095035 1:171391404-171391426 GAGGGAAATAAGGATAAAGATGG - Intergenic
917723469 1:177808531-177808553 GACAGGCACCAGGATGAATAGGG + Intergenic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
918511324 1:185316998-185317020 GATGGGAAGCAGGAGGAAGCGGG + Exonic
918595410 1:186287208-186287230 AAGGGGAAAAAAGATGAAGATGG - Intergenic
918811280 1:189124052-189124074 AAGGGAAACCAGGATTAAAATGG + Intergenic
920724335 1:208419694-208419716 GAAAGGAAGCAGGATGAAGCAGG - Intergenic
921184145 1:212655787-212655809 GAAGGGATACAGGATGAGGAAGG - Intergenic
921333673 1:214065072-214065094 CAGATGACCCAGGATGAAGAAGG - Intergenic
921564986 1:216706040-216706062 GTGGGGGACGAGGAGGAAGAGGG - Intronic
921756675 1:218864707-218864729 GAGGGGAGAAAGTATGAAGAAGG - Intergenic
921963693 1:221064804-221064826 GAGGGGAAGGAAGAGGAAGAAGG - Intergenic
922317304 1:224453875-224453897 GAGGGGAGGGAGGATAAAGAAGG - Intronic
924280342 1:242430694-242430716 GAGGAGAACCAGCAGGTAGAAGG - Intronic
1063060772 10:2550108-2550130 GAGAGGAACAAAGATAAAGAGGG + Intergenic
1063503825 10:6579294-6579316 GAGGGGGACTAGGCTGGAGAAGG - Intronic
1063873992 10:10452512-10452534 GTGGGGAAGGAGGTTGAAGAGGG - Intergenic
1064965436 10:21011476-21011498 GAGGGGAACCAGGAAGCAGGAGG - Intronic
1065203023 10:23331561-23331583 GAAGGGAACCGGGATGGGGAAGG + Intronic
1065367699 10:24952145-24952167 GAGGAGACCCAGGAAGAAGGAGG + Intronic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1066054548 10:31668248-31668270 CAGGGCAACCAGGATGTTGAAGG - Intergenic
1066124517 10:32327313-32327335 GACGGGAAACAGGAAGAAGTTGG + Intronic
1066473361 10:35720811-35720833 GAGGGAAAGAAGGAAGAAGAGGG - Intergenic
1066540398 10:36440569-36440591 GAGGGCAAAGAGGATGAAAAAGG - Intergenic
1066562675 10:36687677-36687699 GATTGTAGCCAGGATGAAGAAGG + Intergenic
1067650962 10:48154874-48154896 GCTGGGAAACAGGAAGAAGAAGG - Intergenic
1067820703 10:49527103-49527125 GAGTGGAACAAGGATAAAAAGGG + Intronic
1068082369 10:52335368-52335390 CAGGGGAGACAGGATGAAGCAGG + Intergenic
1068497606 10:57805277-57805299 GATGTGAAGCAGGATGAAGAAGG - Intergenic
1068515417 10:58019894-58019916 GAGGGCAATCAGGAAGATGAGGG - Intergenic
1068936351 10:62639052-62639074 GAGAGGATCCAGGTTGAGGAGGG + Intronic
1069374866 10:67783613-67783635 GAGAGGAGCCAAGAAGAAGATGG + Intergenic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1071782144 10:88857879-88857901 AAGGGGAACAAAGATGAACATGG + Intergenic
1073340906 10:102743962-102743984 GAAGGGAAGAAGGAAGAAGAGGG + Exonic
1073371645 10:102995153-102995175 GAGGGGGAGGAGGAGGAAGAGGG - Intronic
1073371652 10:102995171-102995193 GAGGGGGAGGAGGAGGAAGAGGG - Intronic
1073842113 10:107509737-107509759 GAGGGGATCCAGGATCAACATGG - Intergenic
1074300357 10:112227570-112227592 GATGGGAACCAGCATGATGAGGG - Intergenic
1074700523 10:116088143-116088165 GAGGACACCCAAGATGAAGAGGG + Intronic
1074732160 10:116390739-116390761 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1075551807 10:123398229-123398251 GAGCAGAACCAGGATCAACAGGG - Intergenic
1075648083 10:124109502-124109524 GCTGGGAGGCAGGATGAAGAGGG + Intergenic
1075774128 10:124968678-124968700 GACAGGAGCCAGGATAAAGAAGG + Intronic
1075802519 10:125161494-125161516 GCGGGGCACCAGGAGGAAGTTGG - Intergenic
1077140461 11:1022029-1022051 GAGGGGCACCGGGCTGCAGAGGG - Intronic
1077321012 11:1941992-1942014 GGGGGGAACTGGGATTAAGATGG + Intergenic
1077565009 11:3292119-3292141 GAAGGGACCCAGGGTGCAGAAGG - Intergenic
1077570895 11:3337936-3337958 GAAGGGACCCAGGGTGCAGAAGG - Intergenic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079202900 11:18390638-18390660 GTGGGGATGAAGGATGAAGAGGG - Intergenic
1079772605 11:24481494-24481516 GAGGGGAACCACAATGAAATTGG + Intergenic
1080099557 11:28443819-28443841 CAGGGGAACAATGATGAAGGTGG - Intergenic
1080787497 11:35489002-35489024 GAGGAGAACCAGGAAGGAGTAGG - Intronic
1081821811 11:46004881-46004903 GAGGGTAGCCATGATAAAGAAGG - Intronic
1082909859 11:58358977-58358999 GAGGGTAAACATGATAAAGAGGG + Exonic
1083336074 11:61922637-61922659 GAGGCTAACCAGAAAGAAGAGGG - Intergenic
1083664608 11:64267704-64267726 GAGGGGCCCCAGGAGGATGAAGG - Intronic
1083897573 11:65627750-65627772 GAGAGGAAGCAGGCTGAAGGAGG + Intronic
1085252274 11:75151685-75151707 GAGGGGAAACGGCTTGAAGAGGG - Intronic
1085550861 11:77369914-77369936 GAGAGGAACCAAGATAAGGAAGG - Intronic
1085811388 11:79685303-79685325 GTGAGGAAACAGGCTGAAGAAGG + Intergenic
1085882691 11:80486424-80486446 GAGAGGAAGCATAATGAAGATGG + Intergenic
1085904759 11:80747035-80747057 GAGGAGAACCAGGTTGGAAAAGG - Intergenic
1086080924 11:82901422-82901444 GAATGGAAGCTGGATGAAGAGGG - Intronic
1088648902 11:111940128-111940150 GAGGGAAGCCAGGATTCAGAGGG - Intronic
1089042234 11:115462910-115462932 GGGATGAAGCAGGATGAAGAGGG + Intronic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089281091 11:117375071-117375093 GAGGGGAACCTGTATGGAAAGGG + Intronic
1089708279 11:120296692-120296714 TATGGGAACATGGATGAAGATGG - Intronic
1090355501 11:126137831-126137853 GAGGTGAAACAGGATGCAGAGGG + Intergenic
1090981158 11:131723733-131723755 GAGGGCAAACAAGATGAAAAAGG - Intronic
1091603128 12:1929918-1929940 GAGGGGGAGGAGGAGGAAGAGGG + Intergenic
1092246901 12:6868747-6868769 GAGCAGAACCAAGAAGAAGAGGG + Intronic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1094716426 12:33018995-33019017 GATGGGAACTAGAAAGAAGATGG - Intergenic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095446319 12:42286773-42286795 GAGGGGAGCCAGGCTGAGGGTGG + Intronic
1096660158 12:53119146-53119168 GAGGCGGCCCAGGATGAAGCAGG - Exonic
1097030067 12:56083496-56083518 GAGGGGTCCCAGGTTGAAAAAGG + Intronic
1100355891 12:93829447-93829469 GGGGGTAGCCAGGATGAGGATGG + Intronic
1100372192 12:93978561-93978583 GAGGAGACCCAGGAGGAAGTGGG + Intergenic
1100550763 12:95644462-95644484 GAGGAGGAGCAGGAGGAAGAGGG - Intergenic
1101413189 12:104486056-104486078 GAGGGGAAGGAAGACGAAGATGG - Intronic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1102214050 12:111147645-111147667 GAGAGGAGACAGGATGAAGATGG + Intronic
1102663506 12:114549775-114549797 GAGGGTGAGAAGGATGAAGATGG + Intergenic
1102865218 12:116368887-116368909 GAGGGGAAGCAGAATGTAGACGG + Intergenic
1103402137 12:120650293-120650315 GAGGGGAACCAAGCTGGAGAAGG - Intronic
1104026604 12:125032110-125032132 GAAGGAAACCAGAATGAGGAGGG + Intergenic
1104095913 12:125557872-125557894 GAGGGGCACCTGGCTTAAGAAGG + Intronic
1104509605 12:129365568-129365590 AAGAGGAACCAGGATGGAGCAGG + Intronic
1106766823 13:32921871-32921893 GGGAGGAAGCAGGAGGAAGAGGG + Intergenic
1107758496 13:43651278-43651300 AAGAGGAACAGGGATGAAGAGGG + Intronic
1109010095 13:56929359-56929381 TATGGGAACCATGGTGAAGAAGG - Intergenic
1112069844 13:95837429-95837451 CCTGGGAACAAGGATGAAGAAGG + Intronic
1113876170 13:113596225-113596247 GCAGGGAAGCAGGATGAAGAGGG + Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114228878 14:20762694-20762716 GATGGGCCCCAGTATGAAGATGG - Intergenic
1114265874 14:21072191-21072213 GAGGGGAGTCTGGATGAAGCAGG + Intronic
1114285464 14:21238663-21238685 GAGGGGAAATATGATGATGAGGG - Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114333807 14:21665807-21665829 GAGGGCAACCACCATGAAGTGGG - Exonic
1115642361 14:35342684-35342706 GAGGAGAAACAGGATGATGGTGG - Intergenic
1115762179 14:36585431-36585453 GAGGGAATCCAAGATGAAGCAGG - Intergenic
1116056208 14:39866657-39866679 GAGGGAGAGCAGGAGGAAGAAGG + Intergenic
1116526343 14:45910531-45910553 GAGAGGAACCCAGATGGAGATGG + Intergenic
1119180390 14:72601062-72601084 GAGGGGGAGGAGGAGGAAGAAGG + Intergenic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1119462295 14:74817025-74817047 GATGGCATCCAGGATGATGAAGG - Exonic
1119716108 14:76860656-76860678 GAGGGGACCCATGATGATGAGGG - Intronic
1121902307 14:97704827-97704849 GAGAGTAACCAGGATGAAAGGGG - Intergenic
1122107127 14:99466682-99466704 GAAGGGAACCCGGCTGGAGAGGG + Intronic
1122160340 14:99779776-99779798 GAGGGGAAGCATCCTGAAGATGG - Intronic
1122676994 14:103423692-103423714 GCGGGGAGCTAGGAGGAAGAGGG + Intronic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1122687178 14:103514900-103514922 GAGGGGAAGAGGGATGCAGAAGG + Intergenic
1122782624 14:104150110-104150132 GAGGGGGACCAGGAGGGGGAGGG - Intronic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1123626708 15:22232160-22232182 GAGGGGAAGGCGCATGAAGATGG + Intergenic
1127343118 15:58066605-58066627 GAGGGGAAACAGCCGGAAGAGGG - Intronic
1128095809 15:64954493-64954515 GAGGAGAAGAAGGAAGAAGAAGG - Intronic
1128249209 15:66152862-66152884 GAGGGTATCCAGGCTGAAGGAGG + Intronic
1128581896 15:68816800-68816822 GAGGGGCTCCATGATGAAGATGG - Intronic
1129710303 15:77817365-77817387 GAGGGGCTCTAGGATGGAGAGGG + Intronic
1129983997 15:79900322-79900344 GAAGGGAAAGAGGAAGAAGAGGG - Intronic
1130028693 15:80292986-80293008 TAGGGGAGCCAGGCTAAAGAGGG - Intergenic
1130143602 15:81254357-81254379 GAATGGACCCAGAATGAAGATGG - Intronic
1130155821 15:81349230-81349252 GAGGAGGACCAGGATGACAAGGG - Intronic
1130209424 15:81909636-81909658 GGTGGGCAGCAGGATGAAGAAGG + Intergenic
1130926235 15:88387934-88387956 CAGGGGAGCCAGGATGACCAGGG + Intergenic
1131728189 15:95250360-95250382 GAGAGGAACCAGGATCATGTAGG + Intergenic
1134186759 16:12090609-12090631 GAGAGAAACCAGGATGGAAATGG - Intronic
1134249635 16:12565445-12565467 GAGAGAACCCAGGATGAGGAGGG - Intronic
1134560287 16:15203183-15203205 GAGGGGAAGCAAGAGAAAGAGGG + Intergenic
1134920829 16:18114797-18114819 GAGGGGAAGCAAGAGAAAGAGGG + Intergenic
1135485762 16:22863346-22863368 GAGGGCATCCTGGAGGAAGAGGG - Intronic
1135563445 16:23494114-23494136 GACGAGAAACAGGAGGAAGAAGG + Intronic
1136187225 16:28595581-28595603 GAAGGGCACCCGCATGAAGATGG + Exonic
1136189704 16:28608509-28608531 GAAGGGCACCCGCATGAAGATGG + Exonic
1137379751 16:47986401-47986423 GTGGGGAAGCAGGATGTAGTAGG + Intergenic
1137502478 16:49022247-49022269 GAGAGGAAGCAGGAGGAAAAGGG + Intergenic
1137546575 16:49408614-49408636 GATGGGAAACAGGATGAGAAGGG + Intergenic
1137802689 16:51275663-51275685 GATGGGAATCAGGATGTAAAGGG - Intergenic
1138318600 16:56091478-56091500 GAGGTGAAACAGGGTGAGGAGGG + Intergenic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138852390 16:60644471-60644493 GAAGGGACACAGGATGAAGGAGG - Intergenic
1139127795 16:64101165-64101187 GAGGGGAAAAAGGATGATGCTGG + Intergenic
1139490434 16:67283153-67283175 GAGGTCAACCAGGCAGAAGAGGG + Intronic
1140251166 16:73295679-73295701 GAGGGTCACCAGGAAAAAGAAGG + Intergenic
1140904046 16:79395355-79395377 TAGGGGTACCAGGTTGAATAGGG + Intergenic
1141977278 16:87525256-87525278 GAGGGGAAGGTGCATGAAGATGG - Intergenic
1142368442 16:89663695-89663717 GAAGGGCAGCAGGAGGAAGATGG + Intronic
1142669519 17:1481430-1481452 GAGGGGAACCAGGCTAAGCAGGG - Intronic
1143309926 17:5979617-5979639 GAGGGAAACCAAGATGAGAAAGG + Intronic
1143762040 17:9111851-9111873 GAGGGGGAGGAGGAAGAAGAGGG + Intronic
1144077164 17:11729727-11729749 GAGGGGGACAAGGATGATGCTGG - Intronic
1144304481 17:13955610-13955632 GAAGAGAACCAGGGAGAAGATGG + Intergenic
1144410252 17:14993916-14993938 GAGGGGATTCAGGATGCTGAAGG + Intergenic
1144665348 17:17098587-17098609 GAGGGAATCCAGGAGAAAGAAGG + Intronic
1145095400 17:20021162-20021184 GAGGGGGAGGAGGAAGAAGAGGG + Intronic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147359945 17:39924194-39924216 GAGGGGCAGCAGGATGAATGTGG - Exonic
1147509860 17:41058786-41058808 GACGGGAACCATGGAGAAGATGG + Intergenic
1148465908 17:47865259-47865281 GAGGGGACCCAGGGTGCAAAAGG + Intergenic
1150105649 17:62460705-62460727 GAGAGGAAAAAGGAGGAAGAAGG - Intronic
1150646089 17:66978392-66978414 GAGGGGACCCAGAGTGAAGATGG + Intronic
1151209860 17:72536493-72536515 GCGGGGAAGCTTGATGAAGACGG - Intergenic
1151394886 17:73816402-73816424 GAAGGCAACCAGAATGGAGAGGG + Intergenic
1151536259 17:74740597-74740619 GAGGAGAGACAGGGTGAAGATGG + Intronic
1151935168 17:77256879-77256901 GAGGGGAGCAAGGAGGTAGAAGG + Intergenic
1152588613 17:81200174-81200196 GCGGGGACCCAGGGTCAAGAAGG + Intronic
1153117276 18:1674987-1675009 GAGGGAAAACAAGATGAAGTGGG + Intergenic
1156671760 18:39479222-39479244 AAGGGGAAACAGGAGAAAGAAGG + Intergenic
1157107369 18:44787167-44787189 GAGTGGAACTAGGATGAGAAAGG + Intronic
1157126604 18:44962182-44962204 GCGGGGACCCAGGATCAGGAAGG + Intronic
1157415678 18:47500774-47500796 CAGGGAAACAAGGATGAAGGGGG + Intergenic
1157680295 18:49600195-49600217 GAGGGGAGCCCTGATGAGGAAGG + Intergenic
1158218235 18:55122639-55122661 GAATGGATCCAGGATGAAGAGGG + Intergenic
1158644304 18:59230948-59230970 CAGGTGAGCCAGGTTGAAGATGG + Intergenic
1158907117 18:62024496-62024518 GAGGAGAACCAGGGTTAAGGGGG - Intergenic
1160173994 18:76578676-76578698 GAGGGGAAGGAGGAAGACGAGGG - Intergenic
1160174579 18:76582225-76582247 GAGGGGAAGGAGGAAGACGAGGG - Intergenic
1160941388 19:1621909-1621931 GAGGAGAAGGAGGATGCAGATGG + Exonic
1161027993 19:2045515-2045537 GAGGAGAAGGAGGAAGAAGAGGG - Intronic
1161668394 19:5590570-5590592 GAGGGGAGCCAGGGAGCAGAGGG - Intronic
1163104563 19:15115930-15115952 GAGGGGACCCAGGATGGTTAGGG + Intronic
1163611552 19:18304451-18304473 GAGGGGAATGGGGAGGAAGATGG + Intergenic
1164292696 19:23881842-23881864 GAGGAGAAGGAGGAGGAAGAGGG + Intergenic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1164838830 19:31377199-31377221 GACGGGAATCAGTTTGAAGATGG - Intergenic
1165205391 19:34180680-34180702 GAGTTGAAGCAGGATAAAGAAGG - Intronic
1165227383 19:34364717-34364739 GAGGAAAACCAAGATGAAAAGGG - Intronic
1165298549 19:34949920-34949942 GAGAGAAACAAGGAGGAAGAGGG + Intergenic
1165790578 19:38489258-38489280 GAGGAGGACGAGGAGGAAGAGGG + Exonic
1165925645 19:39324531-39324553 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1166332800 19:42088448-42088470 GGGAGGAAGCAGGATGAAGTGGG + Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167212347 19:48141046-48141068 GACGGTAACAATGATGAAGATGG + Intronic
1167220452 19:48195525-48195547 GAGGGGAGCCCAGATGGAGAAGG + Exonic
1167487165 19:49769398-49769420 GAGAGGGACTAGGATGGAGAGGG + Intronic
1167499025 19:49835434-49835456 GAGGGGAACTAGTAAGGAGATGG - Intronic
1167597646 19:50435865-50435887 GAGGGGAACCCGGGGGAGGAGGG + Intronic
1167686535 19:50960100-50960122 GAGGGGGAGGAGGATGGAGAGGG + Intronic
924985266 2:264485-264507 GAGGGGTACCTGGAGGAGGAAGG - Intronic
925693354 2:6548343-6548365 GAGGGGGACCTGGAAGAAGCTGG + Intergenic
925927586 2:8681666-8681688 GAGGGGAAGGAGGAGGGAGAAGG - Intronic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926653782 2:15376056-15376078 TAGGGGAACTAGAATGAGGAGGG + Intronic
927433034 2:23042937-23042959 GATGGGAAGGAGGATGAAGAGGG - Intergenic
927490071 2:23515413-23515435 GAGGGGAAGCCAGGTGAAGAAGG - Intronic
927651912 2:24918433-24918455 GAGGGGCAGCGTGATGAAGAAGG + Exonic
927661898 2:25000590-25000612 GAGGAAAACAAAGATGAAGAGGG - Intergenic
927875258 2:26650995-26651017 GAGGGCAGCCAGGCTGGAGAGGG + Intergenic
927965629 2:27265895-27265917 GAGTGGAAGCAGGATGGAGGAGG + Intronic
931375901 2:61707987-61708009 GAAATCAACCAGGATGAAGAGGG - Intergenic
931855706 2:66299737-66299759 GAGGGGAGCCAGCATGGGGAGGG + Intergenic
935261029 2:101356110-101356132 GAGAGGAGCCTGGCTGAAGATGG - Intronic
938251922 2:129822080-129822102 GTGGGGAAACATTATGAAGAAGG - Intergenic
938542507 2:132296165-132296187 GAAGGGAAGAAGGAGGAAGAGGG - Intergenic
940599895 2:155845463-155845485 GAGGGGAGCCAGAAAAAAGATGG - Intergenic
941151455 2:161919654-161919676 GAGGGTGAACAAGATGAAGAGGG - Intronic
941235352 2:162965038-162965060 TAGGGGAATCAGGTTGAAAATGG - Intergenic
943365703 2:186965779-186965801 GTAGGGAAGAAGGATGAAGAGGG + Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
944646481 2:201785585-201785607 GAGGGGAATCAGGAACAAGAGGG + Intergenic
946013457 2:216584999-216585021 GAGAGGCTCCTGGATGAAGAGGG + Intergenic
946060145 2:216934464-216934486 GAAGGGAGCCAGGAAGACGAAGG - Intergenic
946379018 2:219332074-219332096 GAGGGAAAGCAGGATGGAGGGGG - Intronic
947179557 2:227400085-227400107 GGAAGGAGCCAGGATGAAGAGGG - Intergenic
947815473 2:233033773-233033795 TGGAGGAACCAGGATGAAGTTGG + Intronic
948751157 2:240134107-240134129 GAGGGGAAACAGGCTCAAGTTGG + Intronic
1169301597 20:4446251-4446273 GGTGGGAAGCAGGCTGAAGAGGG - Intergenic
1169707263 20:8519493-8519515 GAGAGCAGGCAGGATGAAGAGGG - Intronic
1170146896 20:13185423-13185445 GAGGGTGACAAGGAGGAAGAAGG - Intergenic
1170276294 20:14594180-14594202 GTGAAGAACCAGGTTGAAGAGGG - Intronic
1171724513 20:28603475-28603497 GATGGGAACCAGGATAGAGAAGG + Intergenic
1171753549 20:29079562-29079584 GATGGGAACCAAGATAGAGAAGG - Intergenic
1171788710 20:29498000-29498022 GATGGGAACCAGGATAGAGAAGG + Intergenic
1171858823 20:30376500-30376522 GATGGGAACCAGGATAGAGAAGG - Intergenic
1171897454 20:30821921-30821943 AAGGAGAACCAGGAGAAAGAAGG - Intergenic
1172985298 20:38982606-38982628 GAGGGGAACAGGGATAAAGAGGG - Intronic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173322163 20:41997992-41998014 GAGGGCAAGGAGGAAGAAGAGGG - Intergenic
1173960408 20:47066976-47066998 GAGAGGACCCAGGAAGAAGGGGG - Intronic
1174077266 20:47946501-47946523 GAGAGGAACCAAGAACAAGATGG - Intergenic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175017768 20:55810284-55810306 GATGGTAACAAGGATGAATAGGG - Intergenic
1175757733 20:61540071-61540093 GAGGGGGAGCAATATGAAGAGGG + Intronic
1176239014 20:64067392-64067414 GAGGGGAAGCGGGAGGGAGAAGG + Intronic
1176264778 20:64203508-64203530 GAGGGGAAGAGGGAGGAAGAGGG - Intronic
1177565645 21:22817993-22818015 GAGGGGGAACAGGGTGAGGAAGG + Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177813860 21:25954589-25954611 GAGGAGATTCAGGATGAAGTTGG - Exonic
1178244049 21:30935366-30935388 GAGGGGTCCCAAGGTGAAGATGG + Intergenic
1178882638 21:36461306-36461328 GAGGCCGGCCAGGATGAAGAGGG + Exonic
1179064826 21:38015160-38015182 GTGGGGCACAAGGAAGAAGAAGG + Intronic
1179438663 21:41378866-41378888 GAGGGGAGCCAGGGAGGAGAAGG - Intronic
1180143226 21:45905663-45905685 GTGAGGACCCAGGAAGAAGACGG - Intronic
1180298065 22:10962172-10962194 GATGGGAACCAGGATAGAGAAGG + Intergenic
1180410348 22:12601626-12601648 GATGGGAACCAGGATAGAGAAGG - Intergenic
1180611531 22:17101329-17101351 GGGTGGTCCCAGGATGAAGAAGG - Intronic
1181452595 22:23033914-23033936 CAGGGGAGCAAGGATGAAAATGG + Intergenic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183302299 22:37064296-37064318 GAGGGGCCCCAGACTGAAGAGGG - Intergenic
1183784865 22:40023437-40023459 GAGGGGAAGGAGGTGGAAGAGGG + Intronic
1184300037 22:43553275-43553297 GAGCAGAACCAGGAGGAAGGAGG + Intronic
1184561642 22:45267267-45267289 GAGGGGAGGGGGGATGAAGAGGG + Intergenic
1184563933 22:45279968-45279990 GAGGGGAAACAGGAGAAAAAGGG - Intergenic
1184657073 22:45947200-45947222 GTGGGGAACCAGGGTGAATATGG + Intronic
949101955 3:156247-156269 GAGAGGACTCAGGATAAAGAAGG - Intergenic
949628125 3:5891088-5891110 CAGAGGAATTAGGATGAAGATGG - Intergenic
951005535 3:17611571-17611593 GAGGAAAAGCAAGATGAAGATGG + Intronic
951120022 3:18915741-18915763 GAGGGGAACCAGGAAGTTGTAGG - Intergenic
951556162 3:23922760-23922782 GAGAGGAACTAGGAGGCAGAAGG - Intronic
954104920 3:48404780-48404802 GCGGGGTTCCAGGATGAATAAGG + Intronic
954371160 3:50170217-50170239 GAGGGGAACCAAGGTGGAGAGGG - Intronic
955625866 3:60918619-60918641 AAAGGAAACCAGGAGGAAGAAGG + Intronic
956154284 3:66278400-66278422 GAGTGGAACCAGAATGGAGAGGG - Intronic
956575523 3:70748549-70748571 GTGGGGAAACAAGAGGAAGAGGG - Intergenic
956846536 3:73188825-73188847 GAGGGGGAGGAGGAGGAAGAAGG - Intergenic
957462819 3:80544225-80544247 AAGGGCAGCCAGGATGATGAAGG - Intergenic
957568343 3:81913428-81913450 CAGGAGGACAAGGATGAAGAGGG + Intergenic
958033254 3:88139770-88139792 GAGGAGGAAGAGGATGAAGAAGG + Exonic
959144615 3:102529859-102529881 GTGGGGAATCAGGCTGCAGAGGG - Intergenic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
960871596 3:122255117-122255139 GAGGACAACCAGGATGATGACGG - Intronic
960974934 3:123164353-123164375 AAGGGGCACCAGAATAAAGATGG - Intronic
961219320 3:125187369-125187391 GAGGGCCACCAGGATGACGAAGG + Exonic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
962249223 3:133824948-133824970 CAGGAAAACCAGGATGGAGAAGG - Exonic
962405238 3:135094659-135094681 GAGGGAAAGCAGGAGGGAGAAGG - Intronic
964590647 3:158359851-158359873 GAGGGTGAACAAGATGAAGAGGG + Intronic
964698355 3:159535466-159535488 GAGCAGAACCAGGAGGAAGCAGG - Intronic
964761883 3:160142076-160142098 GAAGGAAACCATCATGAAGAGGG - Intergenic
969417879 4:7073016-7073038 GAGAGGAACCAGAGTGGAGAAGG - Intergenic
969656072 4:8499269-8499291 CAGGGGGCCCAGGCTGAAGATGG - Intergenic
969918704 4:10515341-10515363 GAGAGAAATCAGGATGAGGATGG - Intronic
970383356 4:15530931-15530953 AACGGAAACCAGGATGTAGAAGG + Intronic
970914891 4:21321580-21321602 GAGGGGTAGGAGGAGGAAGAGGG + Intronic
971002693 4:22340360-22340382 GAGGAGAACGAGGAGGAGGAGGG + Intergenic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
971570952 4:28210028-28210050 GAGGGGGAGGAGGAGGAAGAGGG - Intergenic
971570959 4:28210046-28210068 GAGGGGGAGGAGGAGGAAGAGGG - Intergenic
972578669 4:40375599-40375621 GAGGGGAAAGAGGATGAGTATGG - Intergenic
972839847 4:42917726-42917748 TAGGGGAAACAGGATGAACGGGG + Intronic
974686984 4:65243108-65243130 GAGGAGAAGGAGGAAGAAGAAGG + Intergenic
975854246 4:78606276-78606298 AAGGTGATCCAGGATGAAGAGGG + Intronic
976221928 4:82762958-82762980 GAGGGGGACCAGGAAGGCGATGG - Intronic
979295603 4:119030033-119030055 GAGGCGGACGAGGAGGAAGAAGG + Exonic
979508370 4:121524099-121524121 GAAGTGACACAGGATGAAGAAGG + Intergenic
979532843 4:121787438-121787460 GAGTGGGAAAAGGATGAAGATGG - Intergenic
980102246 4:128553300-128553322 GAAGGGAGCCGGGATGAAGCAGG - Intergenic
980896006 4:138861036-138861058 GAGGGGACCCAGGCTGAGAAGGG - Intergenic
981147635 4:141343614-141343636 GAGGGAAGCCAGGATGCAGGTGG + Intergenic
981642414 4:146959839-146959861 GGTGGGAACCAGGCTGAACAGGG - Intergenic
982017362 4:151168260-151168282 GAAGGGAAGCAGGTTGCAGAAGG + Intronic
982027555 4:151266204-151266226 GAAGAAAACCAGGATTAAGACGG + Intronic
982719985 4:158849292-158849314 GAGGGGGAGCAGGAGAAAGAAGG + Intronic
983125798 4:163949587-163949609 GAGGGTAAGCAAGATGAAGCGGG + Intronic
984456661 4:179977686-179977708 GAGGGAGAAGAGGATGAAGAGGG - Intergenic
984551964 4:181171301-181171323 GAGGAGCACCAGGAAGAGGATGG - Intergenic
985314674 4:188643940-188643962 GAGGGGAGACAGGAGGAACATGG - Intergenic
985385581 4:189444193-189444215 CAAGGCAAACAGGATGAAGAAGG - Intergenic
985874166 5:2582889-2582911 GCGGGGACCCTGCATGAAGATGG - Intergenic
986307937 5:6529261-6529283 GAAGGGAACCAGGAGGAGCAGGG - Intergenic
986625810 5:9723036-9723058 GAGTGAAAGCAGGATGGAGATGG + Intergenic
987052696 5:14161340-14161362 AAGGGAAACCAGGAAGAAGAGGG - Intronic
987141727 5:14953375-14953397 GAGGGGACTCAGGAGAAAGAGGG + Intergenic
988443726 5:31261208-31261230 GTGGGCAATGAGGATGAAGATGG - Intronic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
989634626 5:43521054-43521076 GAGGAGGAACAGCATGAAGATGG + Intergenic
990426069 5:55690437-55690459 GAAGGGAAAGAGGATGGAGAAGG + Intronic
993164646 5:84336620-84336642 GAGGAGAAAGAGGTTGAAGAAGG + Intronic
993484715 5:88468781-88468803 GACAGGAACCAGGAAGAGGAAGG - Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
999044839 5:148455921-148455943 GAGGAGGAGGAGGATGAAGAGGG + Intronic
999331523 5:150676763-150676785 GAGGGGCTCCGGGATGAAGGGGG - Exonic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
1000442709 5:161282270-161282292 GAGGGGAACCAGGCTGCCTATGG + Intergenic
1001427384 5:171632132-171632154 GAGGGAAATCATGATGATGATGG - Intergenic
1001738155 5:174023850-174023872 GTGTGGTTCCAGGATGAAGAAGG - Intergenic
1002917170 6:1538658-1538680 GAGGGGAAGAAAGATGGAGAAGG + Intergenic
1003409409 6:5849913-5849935 AAGGTGAACGAGGATGAGGAAGG - Intergenic
1003425640 6:5996622-5996644 GAGGAGAACCAGGATAAAGAGGG - Intergenic
1003817622 6:9859929-9859951 GAGGAGGAGGAGGATGAAGAAGG + Intronic
1005715583 6:28544162-28544184 GCCGGAAGCCAGGATGAAGAGGG - Intergenic
1005896928 6:30186321-30186343 GAGGGGGATGAGGAGGAAGAGGG - Exonic
1005943061 6:30575536-30575558 CAGGGAAACAAGGATGGAGAGGG + Intronic
1007620795 6:43213368-43213390 GAGGGGAGTAAGGATGAAGGAGG - Intronic
1007978869 6:46130090-46130112 AAGGGGGACCTGGAGGAAGAGGG - Exonic
1008042466 6:46816563-46816585 GAGGAGAAGGAGGAAGAAGAAGG + Intronic
1009932653 6:70194393-70194415 AAGGGGCACCAGGATGTTGAAGG - Intronic
1010614999 6:78001930-78001952 TTAGGGAACCAGGATGATGAGGG - Intergenic
1011122445 6:83968126-83968148 GAGGGGGAACAGGAACAAGAGGG + Intergenic
1011888420 6:92126674-92126696 GAGGAGGAGCAGGAGGAAGAGGG + Intergenic
1012993859 6:105953483-105953505 AAGAGGAACCAAAATGAAGATGG - Intergenic
1012994021 6:105955916-105955938 GTGGGCCACCTGGATGAAGACGG + Intergenic
1013335427 6:109154267-109154289 GGAGGGAAAAAGGATGAAGAGGG - Intronic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013618051 6:111862990-111863012 GAGGTGAGCCAGGATGACTAAGG + Intronic
1013625132 6:111929299-111929321 GTGGGGAACATGGATGAAGCTGG - Intergenic
1014391502 6:120871686-120871708 GAGGGGACCGAGGCTGCAGATGG - Intergenic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016386221 6:143533262-143533284 GAGGGTAACAAGGAAGCAGAGGG + Intergenic
1016486812 6:144549639-144549661 TGGGGGAGCCAGGATGAGGAAGG + Intronic
1017687317 6:156926604-156926626 GAGGTGAAACAAGATGAAGGTGG - Intronic
1018612709 6:165660945-165660967 GAGGGGGAGCAGGGTGAGGACGG - Intronic
1018834618 6:167473589-167473611 GAGGGGAGGGAGGATGATGAGGG + Intergenic
1019159136 6:170057742-170057764 GAGGGGAGGGAGGAAGAAGAGGG - Intergenic
1020187399 7:5969816-5969838 GATGGCATCCAGGAAGAAGAGGG - Intronic
1020295517 7:6754954-6754976 GATGGCATCCAGGAAGAAGAGGG + Intronic
1020444625 7:8256341-8256363 GAAGGGAGCCAGGATGTAAAGGG - Intronic
1020786027 7:12573379-12573401 AAGGGGAAACAGGAAGAAGTTGG + Intronic
1022235341 7:28455339-28455361 GAGTGGAACAAGGGTGAAGGTGG + Intronic
1022306709 7:29153454-29153476 GAGGAGAAGAAGGAAGAAGAGGG - Intronic
1022515269 7:30971192-30971214 GAGAGCAACCAGGATGGTGATGG - Exonic
1022841064 7:34164272-34164294 AAGGGAAACAAGGATGAAGTGGG - Intergenic
1023316469 7:38942886-38942908 GAGGGGACCCAGGAAGATGGAGG + Intergenic
1023609197 7:41956985-41957007 AAGGGAAACCAGGAGCAAGAGGG + Intergenic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023982928 7:45080168-45080190 GAGGGGACACAGGGTGATGAAGG + Intergenic
1024049437 7:45609489-45609511 GCGCGGAAACAGGCTGAAGAGGG - Intronic
1024585623 7:50839403-50839425 GAGAAGAACAAGGATGAAGCAGG + Intergenic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026940911 7:74287517-74287539 GAGGGGACTCAGGGTGGAGAGGG - Intergenic
1026980907 7:74526117-74526139 GAGGGGAACCAGGGAGGAGCCGG + Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027878285 7:83799898-83799920 GAGGGGAGGCAGGAGGAATATGG + Intergenic
1027923023 7:84420313-84420335 GAGGGAAACCAGGAAAATGATGG + Intronic
1028861924 7:95662109-95662131 GAAGGGAACCAGGCAGAAGGCGG + Intergenic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1030503272 7:110386548-110386570 CAGGGGAAATAGGATGGAGAGGG + Intergenic
1031075077 7:117203975-117203997 GAAGTGAACCAGGAAGAAGCAGG + Intronic
1032034807 7:128513905-128513927 GAGAGGAAAAAGGAGGAAGAAGG - Intergenic
1032487117 7:132296313-132296335 GAGGTGAACAAGGATTCAGATGG + Intronic
1033041713 7:137925197-137925219 GAGGGGAAGCAGGAGGCAGAGGG + Intronic
1034271145 7:149803916-149803938 CAGGGGATGAAGGATGAAGAAGG + Intergenic
1035031747 7:155865465-155865487 GAAGGGAACAATGATGAGGAGGG - Intergenic
1035419718 7:158717432-158717454 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419745 7:158717571-158717593 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035454161 7:158997994-158998016 GAGGGGAGCGTGGATGAAGGTGG - Intergenic
1035454198 7:158998094-158998116 GAGGGGAGCGTGGATGAAGATGG - Intergenic
1035454232 7:158998196-158998218 GAGGGGAGCGTGGATGAAGATGG - Intergenic
1035454248 7:158998247-158998269 GAGGGGAGCGTGGATGAAGGTGG - Intergenic
1035454265 7:158998298-158998320 GAGGGGAGCGTGGATGAAGGTGG - Intergenic
1035454302 7:158998400-158998422 GAGGGGAGCGTGGATGAAGGTGG - Intergenic
1035454339 7:158998504-158998526 GAGGGGAGCGTGGATGAAGGTGG - Intergenic
1035454356 7:158998555-158998577 GAGGGGAGCATGGATGAAGGTGG - Intergenic
1035454372 7:158998607-158998629 GAGGGGAGCGTGGATGAAGGTGG - Intergenic
1035454407 7:158998708-158998730 GAGGGGAGCGTGGATGAAGATGG - Intergenic
1035454424 7:158998760-158998782 GAGGGGAGCGTGGATGAAGGTGG - Intergenic
1035454442 7:158998812-158998834 GAGGGGAGCGTGGATGAAGGTGG - Intergenic
1035454458 7:158998864-158998886 GAGGGGAGCGTGGATGAAGGTGG - Intergenic
1037300254 8:17444021-17444043 GAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1037455249 8:19057064-19057086 AAGGGGAACCAGTTTTAAGAAGG - Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039351254 8:36766365-36766387 GTGGGGAACCAGAATGAAAAAGG - Intergenic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1041843079 8:62294339-62294361 GAAAGGAACTAGGCTGAAGATGG - Intronic
1042344286 8:67711758-67711780 GAGAGGATTCAGGATAAAGAGGG + Intronic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1044602967 8:94024311-94024333 CAAGGTTACCAGGATGAAGAAGG + Intergenic
1046061509 8:109145120-109145142 GAGAGGAACCAGGGTGAAACTGG - Intergenic
1048005001 8:130411936-130411958 AAAGGGAACCAGGATGGAAAGGG + Intronic
1048215230 8:132487957-132487979 GTGAGGAAGCAGGATGAAGTCGG - Intergenic
1048290488 8:133177697-133177719 GAGGAGAGGGAGGATGAAGAAGG - Intergenic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049311725 8:141937152-141937174 GAGGGTATCCAGGTTGCAGAGGG + Intergenic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1050108309 9:2188807-2188829 GCTGAGAACCAGGATGAACAAGG - Intronic
1050495273 9:6234415-6234437 GAGGGGAAGCAGGGTGGTGAAGG - Intronic
1051985699 9:23084134-23084156 GAGGGGAGCAGGGATGAAAAGGG - Intergenic
1052066918 9:24033715-24033737 GATGGGAAGCAGGACCAAGAAGG - Intergenic
1052255641 9:26453223-26453245 GAGGGGAAGAAGGAAAAAGAAGG + Intergenic
1053160426 9:35810136-35810158 GAGGAGTGCCAGGATGAGGATGG + Intronic
1053670807 9:40359337-40359359 GTGGGGGAGCAGGATGGAGATGG - Intergenic
1053725095 9:40991684-40991706 GATGGGAACCAGGATAGAGAAGG - Intergenic
1054340873 9:63860309-63860331 GATGGGAACCAGGATAGAGAAGG + Intergenic
1054513806 9:66016964-66016986 GTGGGGGAGCAGGATGGAGATGG + Intergenic
1056289495 9:85128399-85128421 GATGGGAACTAGGAAGATGAAGG + Intergenic
1056513363 9:87327130-87327152 GAGGGGGAGGAGGAGGAAGAAGG + Intergenic
1057802134 9:98197085-98197107 GAGGGGAGAAAGGAGGAAGAAGG + Intergenic
1059183242 9:112240071-112240093 GAGGGGTAGAAGGATGAAGTAGG + Intronic
1059729389 9:117041921-117041943 GAGGGGAAACACAATGAATATGG - Intronic
1060367526 9:123033589-123033611 GAGGGGAAACAGGGAGAAGAGGG - Intronic
1060913605 9:127370408-127370430 GAAGGGAACAAGGAAGCAGATGG + Intronic
1060929096 9:127477221-127477243 GAGGGGAACCAGGGTTAGGCTGG + Intronic
1061499717 9:130994861-130994883 GATGGGAGGCAGGATGGAGAGGG - Intergenic
1062182032 9:135196056-135196078 GCGGGAAACCAGGGTGACGAAGG + Intergenic
1062572804 9:137193390-137193412 GAGGGGCAGCAGGGTGAGGAAGG - Intronic
1203449722 Un_GL000219v1:100305-100327 GATGGGAACCAGGATAGAGAAGG + Intergenic
1185623214 X:1465950-1465972 GAGGAACAGCAGGATGAAGATGG + Exonic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1187491567 X:19756989-19757011 GAGGGGAACCAGGTGGCCGAGGG + Intronic
1187551331 X:20308877-20308899 GAGGAGGAAAAGGATGAAGATGG - Intergenic
1190116826 X:47630607-47630629 GAGGGGAAACAGGCTCCAGAAGG - Intergenic
1190598630 X:52068582-52068604 GAAGGGGACCGGGATGAAGGGGG + Intronic
1190610194 X:52185491-52185513 GAAGGGGACCGGGATGAAGGGGG - Intronic
1190828510 X:54040520-54040542 AATGGGAACCAAGAGGAAGAAGG + Intronic
1192503002 X:71665503-71665525 GAGGAGGAGGAGGATGAAGAGGG + Intergenic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1193478945 X:82002935-82002957 GAGGATAAGCAGGAAGAAGAAGG - Intergenic
1197290372 X:124649037-124649059 GAGGGACTCCAGGAGGAAGATGG + Intronic
1197512741 X:127390985-127391007 GAAGGTAAGCAGGTTGAAGAAGG + Intergenic
1197641201 X:128970226-128970248 GAGAGGCAAGAGGATGAAGAGGG - Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198321503 X:135521912-135521934 GGAGGGGACCAGGAGGAAGAGGG - Intronic
1198479792 X:137030929-137030951 GTGGAGAATGAGGATGAAGAGGG - Exonic
1198937721 X:141916435-141916457 GTGGGGCACCAGGTTGAAGGAGG - Intergenic
1199842615 X:151665498-151665520 GATGGAGACCAGGATGAGGAAGG + Intronic
1200247307 X:154533046-154533068 GTGGGGAACCCCGATGGAGAGGG - Exonic
1201304819 Y:12541545-12541567 GAGGGGAAGCGGGAGGAAGGGGG - Intergenic
1201677243 Y:16600334-16600356 GTGGTGAACCAGGATGCAAATGG - Intergenic
1201945435 Y:19505057-19505079 GTGGGGAACAGGGGTGAAGAAGG + Intergenic