ID: 1042396981

View in Genome Browser
Species Human (GRCh38)
Location 8:68304285-68304307
Sequence ATGTATCCAGAAGTGGAATT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042396981 Original CRISPR ATGTATCCAGAAGTGGAATT GGG (reversed) Exonic
903548077 1:24139444-24139466 ATATATCTAAGAGTGGAATTTGG + Intronic
903553898 1:24179605-24179627 ATGGAGCCAGAAGGGGAACTCGG - Intronic
906771853 1:48492229-48492251 TTCTTTCCAGAAGAGGAATTAGG - Intergenic
909277228 1:73702638-73702660 AAGCATCAAGAAGTGGTATTTGG - Intergenic
909739580 1:79011123-79011145 AAGTATCCAGAAACGGCATTAGG - Intergenic
909813668 1:79962986-79963008 ATGTAACCAGAAGTGTAAAATGG + Intergenic
911583049 1:99657571-99657593 ATGTTTTCAGAAGTTGAATATGG - Intronic
912117922 1:106430060-106430082 ATGTATTCAGAAGCAGAATATGG - Intergenic
912365923 1:109133912-109133934 CTGGATCCAAAAGTGAAATTTGG - Intronic
915848636 1:159297212-159297234 ATGTCTGCAGAAGTGGCGTTAGG - Intronic
915884750 1:159710639-159710661 ATTTTTCCAGAAGTAGAATCAGG - Intergenic
916408030 1:164516815-164516837 ATTGATCCAGATGTGGAAATTGG + Intergenic
916782919 1:168055540-168055562 ATGTATCCATACCTGGATTTGGG - Intronic
916876185 1:168971996-168972018 ATGTAGCCACAATTGAAATTTGG - Intergenic
917410713 1:174757387-174757409 ATGTATCCAAAATTAAAATTTGG - Intronic
918525687 1:185462119-185462141 ATGAATCTAGGACTGGAATTAGG + Intergenic
919022789 1:192129779-192129801 ATGAATTCAGAGGTGGACTTAGG - Intergenic
919197059 1:194299443-194299465 CTTTATCCAGCAGTGGAATCAGG - Intergenic
921508739 1:216006477-216006499 ATTTATCCAGAAGTGGGAACTGG - Intronic
921591360 1:217008044-217008066 ATGTATCCTAAAGTAGAACTAGG + Intronic
922904210 1:229161519-229161541 ATGTTTCTAAAATTGGAATTAGG - Intergenic
1065626322 10:27632915-27632937 ATAGATCCAGAAGTAGAAATTGG + Intergenic
1065735189 10:28745133-28745155 ATGTATTCACAGGTGGAATAGGG + Intergenic
1067343322 10:45421216-45421238 ATGTAGGAAGAAGTGGAGTTAGG - Intronic
1069085059 10:64129397-64129419 ACGTATCCAGAAGTGGATCTGGG + Intergenic
1069794875 10:71045657-71045679 ATGTACCCAGAAGAGGAACTGGG + Intergenic
1071007642 10:80901056-80901078 GTGTGTCCAGATGTGAAATTTGG + Intergenic
1071836631 10:89424754-89424776 TTGTTTCCAGAATTGGATTTTGG + Intergenic
1074813834 10:117130281-117130303 ATGTATTCATAAGTAGCATTTGG - Intronic
1078983613 11:16566807-16566829 ATATACCTAGGAGTGGAATTGGG - Intronic
1079003886 11:16779209-16779231 ATGTGTCTAGCAGTGGAATAGGG - Intronic
1079168231 11:18066904-18066926 AGGTTTTCAGAAGTGTAATTTGG - Intergenic
1079448818 11:20581512-20581534 CTTTATCTAGGAGTGGAATTTGG - Intergenic
1080415393 11:32065465-32065487 AGGCATCCAGCAGTGGAGTTGGG - Intronic
1081885422 11:46491792-46491814 AGGCATCCATAAGTGTAATTAGG + Intronic
1085192840 11:74643675-74643697 ATGTATTCAGAAATGAAGTTGGG + Intronic
1086214251 11:84358835-84358857 ATGTATGTAGAAATGGGATTTGG - Intronic
1086490109 11:87350459-87350481 ATGAATACAGATGTGGTATTAGG + Intergenic
1090756749 11:129798396-129798418 ATGTTTCAGGAAGTGGAATTAGG - Intergenic
1092243704 12:6851227-6851249 GTGCATCCAGAGGTGGAATTGGG - Exonic
1093051020 12:14504907-14504929 CTGTCTCCAGAAGTGAGATTTGG + Intronic
1094053474 12:26245371-26245393 AAGTCTTCAGCAGTGGAATTGGG + Intronic
1094658230 12:32441421-32441443 ATGTGTCTAGAAGTGTAATCTGG + Intronic
1095091408 12:38110372-38110394 AAGTATCCAGAAATGTTATTAGG + Intergenic
1096436656 12:51596684-51596706 ATGTATCAATAAGTAGAATATGG + Intronic
1098615979 12:72522945-72522967 AAGTAAACAAAAGTGGAATTAGG - Intronic
1098713034 12:73791701-73791723 ATGTACCCAGTAGTGGGATTGGG + Intergenic
1100534726 12:95497582-95497604 ATATACCCAGAAGTGGATTTGGG + Intronic
1102553186 12:113707359-113707381 ATTTATCGGGAAGGGGAATTAGG - Intergenic
1103584635 12:121942900-121942922 ATGCATCTGGAAGTGGACTTTGG + Exonic
1106817439 13:33424316-33424338 ATTTTTACAGAGGTGGAATTTGG + Intergenic
1107112983 13:36717585-36717607 ATGTACACAGAAATGGAACTGGG + Intergenic
1107310064 13:39067410-39067432 ATGGAACGATAAGTGGAATTTGG + Intergenic
1108596883 13:51956884-51956906 AGGTATTCAGTAATGGAATTGGG - Intronic
1111500434 13:89112842-89112864 ATATAACCACAAATGGAATTAGG - Intergenic
1113275276 13:108721831-108721853 ACATTTCCAGAAGTGGAAATTGG + Intronic
1115434633 14:33358798-33358820 ACGTATCTATAAGTGGAAATAGG + Intronic
1116206528 14:41874594-41874616 ATTTATCAAGTAGAGGAATTTGG + Intronic
1117663346 14:58030983-58031005 ATATACCCAGAAGTAGAATTAGG + Intronic
1118109278 14:62697825-62697847 ATATAGCCAGAAGGGGCATTGGG - Intergenic
1118536250 14:66769061-66769083 AAGTATACTGAAGTGGAATAAGG + Intronic
1118553666 14:66987403-66987425 ATACATCCAGAAGTTGAACTCGG - Intronic
1120265321 14:82241190-82241212 AAGTAACAAGAATTGGAATTAGG - Intergenic
1120288337 14:82534172-82534194 ATGTATCCAGTAGGTGAATTAGG - Intergenic
1121698285 14:95930573-95930595 AGTTATCCAGAAATGGAACTGGG + Intergenic
1124406309 15:29395363-29395385 ATGTACCCAGAAGTGAAATATGG + Intronic
1124463527 15:29915385-29915407 ATTTATGTAGAAGAGGAATTGGG - Intronic
1124807804 15:32904165-32904187 ATGGATCCAGAAGAGGAGCTAGG + Intronic
1126129841 15:45329756-45329778 GAGTATGCAGAAATGGAATTCGG + Intergenic
1126924469 15:53567622-53567644 GTGTATTCAGAAGTGGAATTTGG - Intronic
1127599973 15:60525475-60525497 GTGTATACAGAAGTGGAAGTGGG - Intronic
1128371912 15:67046137-67046159 ATGTAACTAGGAGTAGAATTTGG + Intergenic
1131532828 15:93208239-93208261 ATGAATGCAAAATTGGAATTAGG + Intergenic
1134613093 16:15626657-15626679 ATGTATTAAGAAGTAGAACTTGG + Intronic
1138539843 16:57681200-57681222 ATGTATCCACAGGGGGAATCTGG - Intronic
1141084481 16:81082505-81082527 ATGTATCCATACCTGGATTTGGG - Exonic
1141494727 16:84400275-84400297 ATGTATCTAGGAGTGGGACTGGG + Intronic
1143365014 17:6401717-6401739 ATGTGTCCAACAGTGGTATTAGG - Intronic
1149328969 17:55561704-55561726 ATGCAGCCAGGAGTGGAATCTGG + Intergenic
1150027674 17:61694531-61694553 ATACACCTAGAAGTGGAATTGGG + Intronic
1150238661 17:63614070-63614092 ATGTCTCCAGAAGTGTCTTTGGG - Intergenic
1156085900 18:33402108-33402130 AAGTATTCAGAATTGAAATTTGG - Intronic
1156530191 18:37807647-37807669 ATTTTTCCACAAGTGGAATTGGG + Intergenic
1157598898 18:48880724-48880746 CTGTAGCCAGAAGTAGAAATTGG - Intergenic
1158262453 18:55623402-55623424 ATGTATCTAGAATTAGATTTTGG + Intronic
1158882935 18:61798526-61798548 TTGGATCCAAATGTGGAATTGGG - Intergenic
1159188290 18:65007796-65007818 ATGTCTCAAGAAGTGCAATTTGG + Intergenic
1159719983 18:71877216-71877238 ATGTATACAGATGTGGTAATGGG + Intergenic
1160129532 18:76212458-76212480 TAGTCGCCAGAAGTGGAATTTGG - Intergenic
1160366804 18:78333584-78333606 ATATTTGCAGAAGTGGAATATGG + Intergenic
925619225 2:5774507-5774529 AAGTATCCAGAATGGAAATTAGG + Intergenic
927543818 2:23935727-23935749 ATATACCTAGAAGTGGAATAGGG - Intronic
928215250 2:29355940-29355962 AGGTCTCCAGATGTGGAATTGGG - Intronic
928360636 2:30659602-30659624 ATGTTTCCAGGAGTGGAAGGAGG + Intergenic
930160930 2:48155696-48155718 ATGGATCCAGAAGTGTAGCTGGG + Intergenic
931177213 2:59865978-59866000 ATATTTCCAGGAGAGGAATTTGG - Intergenic
933643802 2:84792966-84792988 ATACATCCAGGAGTGGTATTGGG + Intronic
937824421 2:126351240-126351262 ATATATCCAGAAGTGGAATTGGG - Intergenic
939222044 2:139314836-139314858 ATGTATCCAAATGTGGACTAAGG - Intergenic
940170190 2:150820889-150820911 ATGAATCAAGAAGTTGATTTAGG - Intergenic
941069366 2:160938882-160938904 AGGTATCCAGATGTTGAACTTGG - Intergenic
941317079 2:164007021-164007043 GTGTGTCCAGAAGAGGAAATGGG + Intergenic
943328752 2:186533562-186533584 ATGTATCCAGAAGAATTATTGGG + Intergenic
943737883 2:191377429-191377451 AAGTCTCCAGAAGAGGAAGTGGG - Intronic
945404403 2:209426786-209426808 ATGTAGCCAGAAATGAAACTTGG + Intronic
948627883 2:239280337-239280359 ATGTAACGTGAAGTGGAGTTTGG - Intronic
1168835901 20:877132-877154 AAGTTCCCAGAAGTGGAATCAGG + Intronic
1170104126 20:12735543-12735565 ATTTATCAAGGAATGGAATTTGG + Intergenic
1171784580 20:29450522-29450544 ATGCAACCAGAATTAGAATTAGG + Intergenic
1171937574 20:31289823-31289845 ATGTATCCAGCAGTGAAATTGGG - Intergenic
1177599631 21:23293754-23293776 ATGTAACCAGAATTTGTATTCGG - Intergenic
1177727933 21:24992515-24992537 ATGTATCCAGGAGTAGATTCAGG - Intergenic
1180579224 22:16813614-16813636 ATGTTTCCAGATGTGGAGGTGGG - Intronic
950180015 3:10904862-10904884 ATTTTTTCAGAAGTGGAAATAGG - Intronic
950942324 3:16905230-16905252 ATGTAACCAGAAGAGGTTTTGGG + Intronic
951061120 3:18208430-18208452 ATCTATCCAGCAGAGGAATCTGG - Intronic
952742077 3:36743792-36743814 ATGTGTCAAGCAGAGGAATTTGG - Intergenic
953642520 3:44722579-44722601 ATGTTTCCAGAAATGGAGGTGGG + Exonic
955401798 3:58597207-58597229 AGATATCCAGCAGTGGACTTGGG + Intronic
956002249 3:64741759-64741781 GTCCAACCAGAAGTGGAATTTGG - Intergenic
956034585 3:65077171-65077193 ATATATCTAGTAGTGAAATTTGG - Intergenic
956590042 3:70905054-70905076 CTGAATCCAGAAGTGCATTTAGG + Intergenic
957185517 3:76936662-76936684 ATGTTTCCAGATATGCAATTGGG + Intronic
957902761 3:86516956-86516978 ATGTATCCAGGGTTAGAATTAGG + Intergenic
958811044 3:98860148-98860170 ATGAAGCCAGAAGAGAAATTTGG + Intronic
959367717 3:105483788-105483810 ATGTAAACAGAAGTTGCATTGGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962317692 3:134368980-134369002 ATGCACCCAGAAGGGGAATTCGG - Intronic
965365209 3:167789542-167789564 ATTCAGCCAGAAGTGGAATCAGG - Intronic
965507497 3:169532574-169532596 ATGTTCCCAGAAGTGGAGTTGGG - Intronic
966205951 3:177406548-177406570 AGGTAGCCAGAAGTAGACTTGGG + Intergenic
967211095 3:187169884-187169906 ATGGATCCAGGACTGGATTTGGG - Intronic
969230885 4:5829874-5829896 ATGTTTCTAGATGTGGAGTTGGG + Intronic
970739959 4:19224332-19224354 ATATATCCAGAAGTGGGATTGGG + Intergenic
972816336 4:42650642-42650664 ATGTATCCAGAAGTTGTTTTAGG - Intronic
973181479 4:47274152-47274174 ATGTAGCAAGAAGTAAAATTTGG - Intronic
974472046 4:62331279-62331301 ATGTGTTTAGAAGTGGATTTTGG - Intergenic
978915958 4:114126323-114126345 ATGGATTCAGTAGTGGAATGGGG + Intergenic
980828244 4:138097743-138097765 ATGAATCTACTAGTGGAATTGGG + Intergenic
981186296 4:141807798-141807820 ATGTATCCAAGAATGGAAGTGGG - Intergenic
982293605 4:153804533-153804555 CAGTTTCCAGAAGTGGACTTTGG + Intergenic
982876934 4:160662343-160662365 ATGGATCAATAAGTGGAATGTGG + Intergenic
985319434 4:188693193-188693215 ATGTTTCCAGACTTGCAATTTGG - Intergenic
987803925 5:22737249-22737271 ATGTATCTTGAAGTGAAAATAGG - Intronic
987834150 5:23140112-23140134 TTTTATCCAGATGTGGAATGTGG + Intergenic
990405036 5:55480898-55480920 ATGTATCAAAAAGCGGAATGTGG - Intronic
990627103 5:57626365-57626387 AGGTATCCAGGACTGGACTTTGG - Intergenic
991212831 5:64126416-64126438 ACATATCCAGAAGCTGAATTAGG + Intergenic
991599933 5:68342067-68342089 AAGTATCTGGAAGTGGATTTGGG - Intergenic
992392950 5:76346121-76346143 ATGTCTCCAAATGTGGAGTTGGG + Intronic
993074296 5:83208467-83208489 ATATATCCAGAAGTAGAGTAGGG + Intronic
993372908 5:87114719-87114741 AGGTATCCAAAATTGGAATGAGG + Intergenic
993542169 5:89165257-89165279 ATAGATCAAGAAGTGGAACTGGG + Intergenic
994412496 5:99425224-99425246 ATGAATTCAAAAGTGGAAGTTGG + Intergenic
994481324 5:100340031-100340053 ATGAATTCAAAAGTGGAAGTTGG - Intergenic
998409182 5:141895811-141895833 ATGTATCCATACCTGGATTTGGG - Intergenic
998681796 5:144476173-144476195 ATGGGTCAAGAAGTTGAATTTGG + Exonic
998866863 5:146514244-146514266 ATGAGTCCAGAATTGGAATAAGG + Exonic
998923691 5:147099196-147099218 ATGGAGCCAGAAATGGAATCAGG - Intergenic
1002508585 5:179698260-179698282 ATGTTTCCTGAAGTGAGATTAGG - Intronic
1002649061 5:180678479-180678501 AAGTACTCAGAAGTGGAGTTGGG + Intergenic
1003344459 6:5254272-5254294 ATGCTTCAAGAAGTGGAAGTTGG - Intronic
1004166665 6:13262715-13262737 AGGTATCCAGAAGTGTAGATGGG - Intronic
1004322554 6:14643920-14643942 ATCTTTCCAGAACTTGAATTAGG - Intergenic
1005150790 6:22748066-22748088 ATGTAAACAGAAGTGGTCTTGGG - Intergenic
1005589236 6:27307984-27308006 ATATATCCAGAAGTGAGATTGGG + Intronic
1007825642 6:44598810-44598832 GTGTATCCAGAACTGAAAGTCGG + Intergenic
1007851948 6:44811550-44811572 ATGTATGCAGATGTGGAAGGTGG + Intronic
1010017533 6:71122244-71122266 ATGTTTCAGGCAGTGGAATTAGG + Intergenic
1011570812 6:88732488-88732510 AAATACCCAGAAGTGGAATCTGG - Intronic
1011899184 6:92271003-92271025 ATGGAGCCAGAATTTGAATTCGG - Intergenic
1012123281 6:95393754-95393776 ATGTATCAAGAAGTTGAGCTTGG - Intergenic
1015382209 6:132582486-132582508 ATTTAAAAAGAAGTGGAATTTGG - Intergenic
1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG + Intergenic
1015961083 6:138650051-138650073 GTCTATCCAGATGTGGAGTTGGG - Intronic
1016588198 6:145713696-145713718 GTGTACCCAGAAGTGGAATATGG - Intronic
1017577593 6:155822333-155822355 ATGTAGCCAGAAGGAGAATCAGG - Intergenic
1017659598 6:156661117-156661139 ATGGACACAAAAGTGGAATTAGG + Intergenic
1017852131 6:158314017-158314039 ATGTATGCAGCAGTGGAACATGG + Exonic
1019858753 7:3636708-3636730 ATATACTCAGAAGTGGGATTTGG + Intronic
1023712388 7:43008735-43008757 ATGGATGTGGAAGTGGAATTTGG + Intergenic
1024007393 7:45236735-45236757 ATGTATGCAGAGATGGACTTTGG + Intergenic
1027679155 7:81197493-81197515 ATGGACCCAGATGTGGAACTGGG + Intronic
1027781769 7:82529005-82529027 ATGTACACAGAAGTGGTTTTTGG + Intergenic
1028492313 7:91425684-91425706 ATTTATCCAGAAAAGAAATTAGG + Intergenic
1028658471 7:93238124-93238146 ATGTATATAGAAGTGTAGTTTGG + Intronic
1028682784 7:93556186-93556208 ATGAAAACAGAAATGGAATTTGG + Intronic
1029028256 7:97441303-97441325 ATGTACCCAAGTGTGGAATTGGG + Intergenic
1031466146 7:122114739-122114761 ATGTTTCAAGAAGTGGAGGTGGG + Intronic
1032424950 7:131815089-131815111 ATGTGCCCTAAAGTGGAATTTGG - Intergenic
1032757909 7:134908917-134908939 ATGTGTCTAGAAGTTGATTTTGG - Intronic
1033170352 7:139078412-139078434 ATATACCCAGAAGTGGAGTTGGG - Intronic
1037101327 8:15050721-15050743 ATGTGTGGAGAAGGGGAATTGGG + Intronic
1037458561 8:19086207-19086229 ATTTATAAAGAAGTGAAATTTGG - Intergenic
1039021646 8:33214091-33214113 AAATACCCAGAAGTGGGATTTGG - Intergenic
1042396981 8:68304285-68304307 ATGTATCCAGAAGTGGAATTGGG - Exonic
1042774407 8:72413973-72413995 ATGTATCCAGAAGTAGAGTGTGG + Intergenic
1043075566 8:75694910-75694932 ATTCATCAAGAAGTGGTATTGGG + Intergenic
1045454602 8:102365093-102365115 ATTTATTCTGAAATGGAATTTGG - Intronic
1046301451 8:112297402-112297424 ATTTATCCAGAAATGAAGTTTGG + Intronic
1049344359 8:142130505-142130527 AGGTCTCCAGCAGTGGAATGTGG + Intergenic
1050241406 9:3639689-3639711 ATATATCCAGTAGTGGGTTTAGG - Intergenic
1052598900 9:30599231-30599253 ATGTATCTAGAAATGGGATTGGG + Intergenic
1052610123 9:30760606-30760628 ATGGATCCACAACTGAAATTTGG + Intergenic
1056300679 9:85237387-85237409 ATATTTAAAGAAGTGGAATTGGG + Intergenic
1056545265 9:87607686-87607708 ATGTAACCAGCAGTCTAATTGGG + Intronic
1056964313 9:91153251-91153273 ATGTATCCACAGGAGCAATTGGG + Intergenic
1059958111 9:119539464-119539486 AGGTAAGCAGAAGTGAAATTTGG - Intergenic
1061455977 9:130698132-130698154 ATGTGTCCAGGTGTGGAACTTGG + Intronic
1188019422 X:25141022-25141044 ATGGCTCCAGAAGTGGAAACAGG - Intergenic
1189337414 X:40178510-40178532 AGGTAACATGAAGTGGAATTTGG - Intergenic
1192910203 X:75595915-75595937 AAGTATTCAGCAGAGGAATTGGG + Intergenic
1193246203 X:79232696-79232718 ATGTATCCAGAAAGGTTATTTGG + Intergenic
1193371066 X:80697826-80697848 ATATACCCAGTAATGGAATTTGG + Intronic
1193706428 X:84825316-84825338 AAGTATCTAGAGGTGGAATGGGG + Intergenic
1194207212 X:91025898-91025920 AGGCATCCATAAGTGGATTTTGG - Intergenic
1194297900 X:92149169-92149191 AGTTATCCACAACTGGAATTGGG - Intronic
1195634688 X:107100731-107100753 ATATATCTAGGAGTGGAATTGGG - Intronic
1196021793 X:110998585-110998607 CAGTATCTAGAAGAGGAATTAGG + Intronic
1196102299 X:111859231-111859253 ATGTATCCAGGGGTCGATTTTGG + Intronic
1198266596 X:135015018-135015040 ATGCATCCAGTAGTGTAACTGGG - Intergenic
1198510813 X:137349723-137349745 ATGTATCCAGGAATGGGTTTCGG - Intergenic
1199204527 X:145133005-145133027 ATATACCCAAAAGTGGGATTTGG - Intergenic
1200552952 Y:4600645-4600667 AGGCATCCATAAGTGGATTTTGG - Intergenic
1200615509 Y:5374139-5374161 AGTTATCCACAACTGGAATTGGG - Intronic