ID: 1042397194

View in Genome Browser
Species Human (GRCh38)
Location 8:68306430-68306452
Sequence CTCCACCTCCCCAGCGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 9, 3: 28, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042397190_1042397194 23 Left 1042397190 8:68306384-68306406 CCAGGCATAGTTCACAATCTTTC 0: 1
1: 8
2: 3
3: 22
4: 157
Right 1042397194 8:68306430-68306452 CTCCACCTCCCCAGCGTGGCAGG 0: 1
1: 0
2: 9
3: 28
4: 257
1042397191_1042397194 -4 Left 1042397191 8:68306411-68306433 CCTAACACCTGTGCTCATGCTCC 0: 1
1: 0
2: 3
3: 31
4: 277
Right 1042397194 8:68306430-68306452 CTCCACCTCCCCAGCGTGGCAGG 0: 1
1: 0
2: 9
3: 28
4: 257
1042397189_1042397194 24 Left 1042397189 8:68306383-68306405 CCCAGGCATAGTTCACAATCTTT 0: 1
1: 8
2: 2
3: 23
4: 194
Right 1042397194 8:68306430-68306452 CTCCACCTCCCCAGCGTGGCAGG 0: 1
1: 0
2: 9
3: 28
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042397194 Original CRISPR CTCCACCTCCCCAGCGTGGC AGG Intronic
900214828 1:1475830-1475852 CTCCTCCTCCCCAGAGTCACTGG + Intronic
900222041 1:1514184-1514206 CTCCTCCTCCCCAGAGTCACTGG + Intronic
900959691 1:5910918-5910940 ATCCAACTGCCCAGCCTGGCGGG + Intronic
902036362 1:13461064-13461086 CTTCACACCCCCAGGGTGGCTGG + Intergenic
902220116 1:14959258-14959280 CTCCACATCACCTGCGTGGAAGG - Intronic
902568719 1:17332797-17332819 CACCCCCTCCCCAGCCTGCCTGG - Intronic
903693706 1:25192523-25192545 TTCCACCACCCCAGTGTGGAAGG + Intergenic
904886023 1:33739079-33739101 CTCCCCCTCCCCAGCCTCTCTGG + Intronic
905398295 1:37682552-37682574 CACCACCTCCCCCTGGTGGCAGG + Exonic
905664650 1:39755690-39755712 CTCCACCTCCCCAGAGTATCAGG - Intronic
905741435 1:40374254-40374276 CCCCACCACCCCGGCGCGGCTGG - Intronic
907385035 1:54120736-54120758 TTCCACCTACCCCGCGTTGCAGG - Intergenic
910101320 1:83581910-83581932 TTCCACCCGCTCAGCGTGGCAGG + Intergenic
910459542 1:87434390-87434412 CTCCTCCTCCCCAGCCAGGCTGG - Intergenic
912262288 1:108121941-108121963 CTCGCCCTCCTCAGAGTGGCAGG + Intergenic
914316774 1:146520702-146520724 CTCCTCCTCCCCAGCCAGGCTGG - Intergenic
914497581 1:148212658-148212680 CTCCTCCTCCCCAGCCAGGCTGG + Intergenic
916501014 1:165386958-165386980 CTCCACCTCCTCCACATGGCTGG - Intergenic
917852470 1:179077186-179077208 CTCAGCCTCCCCAGAGTAGCTGG - Intergenic
918202521 1:182280427-182280449 CTACCCCTCCCCAGCTTGGAAGG - Intergenic
919166869 1:193906477-193906499 CTCCAGCTAACCAGTGTGGCTGG - Intergenic
920348473 1:205321886-205321908 CTCCTCCCCCTCGGCGTGGCCGG + Intergenic
924945725 1:248845609-248845631 CTACTCCTGCCCAGCGTGGTGGG + Exonic
1062902382 10:1156157-1156179 CTCCACATCCCCAGGGTAGCTGG - Intergenic
1064682067 10:17820073-17820095 CTCACCCTCCTCAGCGTGGGTGG - Intronic
1066012768 10:31209662-31209684 TCCCACTTCCCCAGCCTGGCTGG + Intergenic
1067053940 10:43040614-43040636 CCCCACCCCCACAGCATGGCAGG - Intergenic
1067108635 10:43382877-43382899 CTCAAACTCCTCAGCTTGGCCGG + Intergenic
1067732325 10:48820979-48821001 CACCGCCTCCCTAGCCTGGCTGG - Intronic
1067744347 10:48924128-48924150 CTTCACCTCCCCAGGGAGTCTGG + Intronic
1069633231 10:69910271-69910293 CTGCTCCTCCCCAGGGTGGTAGG - Intronic
1069978697 10:72237059-72237081 CTCCCCTTCCCCAACATGGCTGG + Intergenic
1070835546 10:79445134-79445156 CCCCACCGCCCCACCGTGGCGGG - Intronic
1073329285 10:102660387-102660409 GTTCCCCTCCCCAGTGTGGCAGG + Intergenic
1075731370 10:124638683-124638705 CTCCCCCGCCCCAGCATGCCTGG - Intronic
1076579729 10:131499279-131499301 CTCTGCATCCCCAGCATGGCCGG + Intergenic
1077324979 11:1959774-1959796 CTGGACATCCTCAGCGTGGCAGG + Intronic
1077368674 11:2171608-2171630 CTGCTACTCCCCAGCCTGGCTGG - Intronic
1078186969 11:9060380-9060402 CTTCACCTCCCCAGGGAGACTGG - Intronic
1079459938 11:20670163-20670185 CTACCCCTTCCCAGCCTGGCGGG - Intronic
1081625511 11:44653033-44653055 CCCCACCTCCCCAACGTGGTGGG + Intergenic
1081732885 11:45383987-45384009 CTCCACCTTCCCAGAGTTGTGGG - Intergenic
1083371582 11:62186369-62186391 CTCCACCTCACCAGCACAGCGGG - Intergenic
1083765232 11:64838453-64838475 CTCCCCCACCCCAGTTTGGCTGG + Intronic
1083813087 11:65116505-65116527 CTCCAGCTCCCCAGTGAGGGCGG + Exonic
1084164224 11:67367467-67367489 CACCAACTCCGCAGCTTGGCTGG - Exonic
1084741926 11:71145767-71145789 CCCCCCTTCCCCATCGTGGCTGG + Intronic
1085655340 11:78309552-78309574 CTCAACCTCCCCAGGGTTGAGGG + Intronic
1086506778 11:87513315-87513337 CTGCAGCACCCCAGCCTGGCAGG - Intergenic
1086961400 11:92982668-92982690 CCCCTTCCCCCCAGCGTGGCAGG + Exonic
1087182005 11:95150741-95150763 CCCCACCTGCCTACCGTGGCCGG + Intergenic
1090239363 11:125171206-125171228 CTGCCCCTCCCCAGCAAGGCAGG - Intronic
1202807961 11_KI270721v1_random:14953-14975 CTGGACATCCTCAGCGTGGCAGG + Intergenic
1092708254 12:11308278-11308300 CTCCACCTCCTCAAGGGGGCAGG - Exonic
1094199964 12:27785126-27785148 CTCCACCTCTCAACCATGGCTGG + Intronic
1095147710 12:38750472-38750494 CTCCACCTCTGCAGCTTTGCAGG - Intronic
1095699388 12:45175248-45175270 CTCAGCCTCCCCAGAGTAGCTGG - Intergenic
1096298714 12:50406831-50406853 CTCAACCTCCCCAGTATAGCTGG + Intronic
1096747576 12:53738703-53738725 CTCCACCTCCCCTGAGCGGCGGG - Intergenic
1096879915 12:54659131-54659153 CTGCACCTCCCTAGCCTTGCTGG + Intergenic
1096881675 12:54678238-54678260 CAGCACCTCCACAGCGTGCCAGG - Intergenic
1097672775 12:62559668-62559690 CTCAGCCTCCCAAGTGTGGCTGG - Intronic
1101964598 12:109273820-109273842 CACCAGCTCCCAAGCGTAGCAGG + Intergenic
1102201185 12:111059204-111059226 CTCCAGCTGACCAGTGTGGCAGG - Intronic
1102254864 12:111409662-111409684 CCCCACCTCCCCAGCTTCCCGGG + Intronic
1102560687 12:113760171-113760193 CTCCGCCTCCCCAAAGTGCCGGG - Intergenic
1104016305 12:124964704-124964726 CTCCAGCACACCAGCCTGGCTGG - Intronic
1104942771 12:132402662-132402684 CTCCACCTCCCCAACTTGTGGGG + Intergenic
1110005111 13:70255941-70255963 CTCCACCCACTCAGCCTGGCAGG - Intergenic
1112370472 13:98788772-98788794 TTCCCCCTCCCCAGTGAGGCAGG + Intergenic
1112757426 13:102653507-102653529 CTCAGCCTCCCTAGAGTGGCTGG + Intronic
1113767842 13:112892075-112892097 CTCCACCTGCACACCGTGGACGG - Intergenic
1115010108 14:28536115-28536137 GTCAACCTCCCCAGTGAGGCTGG + Intergenic
1118397300 14:65348390-65348412 CTCCATCTCCCCAGCACAGCTGG + Intergenic
1119036343 14:71232819-71232841 TTCCACCCCCTCAGCCTGGCAGG - Intergenic
1120993430 14:90397773-90397795 CGCCACCTCCCCACTTTGGCCGG + Intronic
1121236429 14:92394488-92394510 CTCAAACTCTCCTGCGTGGCTGG - Intronic
1121791904 14:96705055-96705077 CTCCACATGCCCTGTGTGGCAGG + Intergenic
1122666702 14:103334759-103334781 CGCCCCCTCCCCGGCATGGCGGG + Intronic
1123033366 14:105461532-105461554 CTCCACCTCCCCAGGGCTGATGG - Intronic
1125919646 15:43517914-43517936 GTCCACCTCTCCAGCTGGGCGGG + Intronic
1126119871 15:45242024-45242046 CTTCTCCTCCTCAGCGTGGAAGG + Intergenic
1128237476 15:66078018-66078040 CCCCACCTCCCAAGTGTGGGAGG + Intronic
1129152291 15:73696674-73696696 CTGTACCTGCCCAGAGTGGCAGG + Intronic
1129245860 15:74278265-74278287 GTCCACTTCCCCACAGTGGCAGG - Intronic
1129488310 15:75899007-75899029 CTCCACCTCCCCAAAGTGCTGGG - Intronic
1129518330 15:76170540-76170562 CTCTAACTCTCCAGCGGGGCAGG - Intronic
1130395127 15:83494792-83494814 CTCCGCCTCCCCAGTGTGCTGGG + Intronic
1130560300 15:84952772-84952794 CTCGACCTCCCAGGAGTGGCTGG - Intergenic
1132639702 16:972173-972195 CTCCACCTTCCCTGTGTTGCTGG + Intronic
1132925921 16:2429157-2429179 CCCCGCCTCCCCAACGGGGCTGG - Intergenic
1134589984 16:15444639-15444661 CTCCTCCCACCCAGCCTGGCAGG - Intronic
1136062136 16:27734002-27734024 CTCCACCTCCACTGGGTGGTGGG - Intronic
1136147257 16:28322663-28322685 CTCCACCTCCCCAGTGGGTATGG + Exonic
1137995277 16:53204155-53204177 CTTCACCACCCCAGCCTGCCAGG + Intronic
1138181128 16:54940703-54940725 CTCCACCTTCCCAGCTTTCCTGG + Intergenic
1139572878 16:67824306-67824328 CTGCACCTCCTGAGCCTGGCAGG - Intronic
1139640866 16:68290558-68290580 CTCTCACTCCCCAGCTTGGCTGG + Intronic
1139911236 16:70398813-70398835 CTCCCCCTCACCAGGGTGGCAGG - Exonic
1140220543 16:73040526-73040548 GTCCCCCTCCCCAGGCTGGCAGG - Intronic
1141594271 16:85087915-85087937 CTCCCGCTCCCCAGGTTGGCTGG + Intronic
1141675892 16:85517161-85517183 CTTCATCTCCCCAGCGAGGGGGG - Intergenic
1143032774 17:3976971-3976993 ACCCAGATCCCCAGCGTGGCAGG + Intergenic
1143103996 17:4519450-4519472 CTCCTCCTCGCCAGGCTGGCAGG - Intronic
1143135880 17:4711981-4712003 CTGCTCCTCCCCAGCCTGGCAGG + Intronic
1143319297 17:6057708-6057730 CTGTAACTCCCCAGTGTGGCCGG - Intronic
1143539616 17:7561434-7561456 CTCCATTGCCCCGGCGTGGCAGG + Exonic
1143651739 17:8267529-8267551 CTCCCCCTCCCCACCTTCGCAGG + Exonic
1144784429 17:17823817-17823839 CCCCACCTCCCCACGGCGGCGGG + Intronic
1145993591 17:29093289-29093311 CTCCACCCACCAAGCCTGGCCGG - Intronic
1146146833 17:30426315-30426337 CTCCAATTCTCCTGCGTGGCTGG - Intronic
1146946906 17:36879705-36879727 CTGCACCTCTCCAGCTTGGCTGG + Intergenic
1147359582 17:39922516-39922538 CTTCCCCTGCCCAGGGTGGCAGG - Exonic
1147751641 17:42738874-42738896 CTCCACCCCCCCTGAGTAGCTGG + Intronic
1147961180 17:44168555-44168577 CTCCCCTTCCCCAGCTTGGCAGG + Intergenic
1149044277 17:52226172-52226194 CTTCACCTCCCAAGAGTGGCTGG - Intergenic
1151361494 17:73591962-73591984 CCCCACGTCCCCAGAGAGGCTGG - Intronic
1151551735 17:74826310-74826332 CCCCCTCTCCCCAGGGTGGCAGG - Intronic
1151727163 17:75891943-75891965 CTCCACCCCCCCAGCGGGAGGGG + Intronic
1152793978 17:82297957-82297979 CTCCTCCTCCCCAGCCTCGCTGG - Intergenic
1152938454 17:83153719-83153741 CTCCCTCCCCCCAGCGGGGCAGG - Intergenic
1154281029 18:13003604-13003626 CACCACCTCCCCAGCCTCCCTGG - Intronic
1155284261 18:24272049-24272071 CTCCCCTTCCCCAGCGCCGCTGG + Intronic
1155553346 18:26990916-26990938 TGCTGCCTCCCCAGCGTGGCTGG + Intronic
1156133421 18:34006392-34006414 CTCACCCTCACCAGTGTGGCTGG + Intronic
1160622071 18:80178662-80178684 CTCCACCCTCCCATCCTGGCAGG - Intronic
1160753257 19:745205-745227 CTCCAGTTCCCCAGGGTGGGTGG + Intronic
1160840959 19:1146857-1146879 CTCCTTCTCCCCAGGGTCGCGGG - Intronic
1160890681 19:1377271-1377293 CTCCACCTCCCCCGCCCGCCTGG + Exonic
1160904482 19:1445972-1445994 TTCGAACTCCCCAGCGTGGTCGG + Intergenic
1161320180 19:3637499-3637521 CCCCTTCTCCCCAGGGTGGCCGG + Intronic
1161853339 19:6750279-6750301 CCCCTCCTCCCAGGCGTGGCTGG + Exonic
1162020620 19:7866855-7866877 CCCCAGCTCCCCAGCATGTCAGG + Intergenic
1162097657 19:8320720-8320742 CTCTGCCTCCACAGCCTGGCAGG + Intronic
1162536304 19:11264570-11264592 CTCCACCTGGCCAAAGTGGCTGG - Intergenic
1162770521 19:12946346-12946368 CTCCACGTTCCCAGCTTTGCAGG + Intronic
1162837708 19:13332051-13332073 CCCAACCTCCCCAGCATAGCTGG - Intronic
1163222219 19:15929794-15929816 ATCCACCTCCCCAGTGGGGGTGG + Intronic
1163405563 19:17119942-17119964 CTCAAACTCCCGAGCTTGGCCGG - Intronic
1163828288 19:19535772-19535794 CTCAATCTCCCCAGCTTGGATGG + Exonic
1166326463 19:42053929-42053951 CCCCACCTCCCCACCCTGCCAGG - Exonic
1166668908 19:44698199-44698221 CTCCACCACCCCACCTTGCCTGG - Intergenic
1167575652 19:50316279-50316301 CTCCCCCTCCCCAGCCAGCCCGG - Intronic
1167665049 19:50818891-50818913 CCCCACCTCCCCACCAGGGCAGG + Intergenic
1168721132 19:58555634-58555656 TTCCACCACCCCAGCTTTGCAGG + Intergenic
925611225 2:5705309-5705331 CTCCTCCTCCCCAGCCTCCCTGG - Intergenic
926686751 2:15704100-15704122 CTCCCCCTCCCCAGCCTCCCTGG - Intronic
932238843 2:70142104-70142126 CTCCTCCTCCCCGACCTGGCCGG + Intergenic
932406005 2:71513055-71513077 CACCACCTCCCAGGCGTGTCTGG - Intronic
932595044 2:73088346-73088368 CTCCTCCTCTCCAGGGTGGCTGG + Exonic
932967630 2:76496046-76496068 CTCTACCTCCCCAGCTCTGCTGG - Intergenic
933418990 2:82023707-82023729 CTCCTCCTCCTCAGTGTGGAAGG - Intergenic
937160931 2:119760171-119760193 TGCCACCTCCCCAGCGGCGCCGG + Exonic
937897742 2:126991262-126991284 CTCCACCTCCCCTGCCGGGGAGG - Intergenic
938082635 2:128378390-128378412 CTCCATCTCCCAGGAGTGGCGGG + Intergenic
941741098 2:169036095-169036117 CTCCACCTCCACATCATGTCTGG + Intergenic
944147110 2:196517818-196517840 CTCAACCTCCCCAGAGTTTCAGG + Intronic
944685488 2:202113782-202113804 CTCCACCTCTGCAGGGTGGTTGG - Intronic
947395005 2:229677593-229677615 CACCACCACCCCAGGGTGGAAGG + Intronic
948271085 2:236673842-236673864 CTCCTCATCCCCAGCACGGCTGG - Intergenic
948903423 2:240967127-240967149 CTCCACCTCCCCAGGCCTGCAGG + Intronic
1169142724 20:3235383-3235405 CTCCGCCTCCCCAGGAGGGCAGG + Intronic
1169345187 20:4823441-4823463 CACCGCCTGCCCAGCCTGGCTGG - Intronic
1170226305 20:13995322-13995344 CTCCAGCTCCCTAGCGTCGTCGG + Intronic
1171498803 20:25577366-25577388 GTCCTCCTCCCGAGCATGGCTGG + Intronic
1172650865 20:36500460-36500482 CTCCAGCTCCCCAGCAGAGCCGG + Exonic
1172943093 20:38667866-38667888 CTCCAGTTCCCCAGCGTGAGTGG - Intergenic
1174204683 20:48829577-48829599 CTCCACTACCCAAGCGTGACAGG - Intergenic
1174464941 20:50710099-50710121 CTCAACCTCCCAAGAGTAGCTGG - Intergenic
1175290427 20:57871532-57871554 CTCCACCTCCCCATGGGGTCTGG + Intergenic
1175904993 20:62375305-62375327 CTCCCCCTCCCCCTCCTGGCAGG - Intergenic
1176074068 20:63240554-63240576 CACCACCTCTCCAGGCTGGCAGG + Intergenic
1176549605 21:8215358-8215380 CTCCACCTCCCCGGCGCGGCGGG - Intergenic
1176557496 21:8259587-8259609 CTCCACCTCCCCGGCGCGGCGGG - Intergenic
1176568530 21:8398392-8398414 CTCCACCTCCCCGGCGCGGCGGG - Intergenic
1176576441 21:8442621-8442643 CTCCACCTCCCCGGCGCGGCGGG - Intergenic
1177112802 21:17049151-17049173 CTCCACCCACTCAGCCTGGCTGG + Intergenic
1177894871 21:26845930-26845952 CTCCACCTTCCCAGCCTGCCAGG + Intergenic
1178265150 21:31135959-31135981 TTCCACTTGCCCAGCGAGGCCGG + Exonic
1178847563 21:36186506-36186528 TTCCACTTCCCCAGTGTGTCAGG - Intronic
1179305721 21:40152495-40152517 CTCCCCCTTCCTAGCCTGGCAGG + Intronic
1179454674 21:41490886-41490908 CACCACCTCTCCAGCCTGGGAGG - Intronic
1179906993 21:44427628-44427650 CTCCACCTCCTCCTCATGGCAGG - Intronic
1181440282 22:22932106-22932128 CTCCTTCTCCCCAGGGTGGGAGG + Intergenic
1181755076 22:25018033-25018055 CTCCTCCTCCTCTGCTTGGCTGG + Intronic
1182475480 22:30574478-30574500 CTCCTCCGCCTCAGCGTGGCTGG + Intronic
1183355276 22:37355465-37355487 CTCCACCTCGCCACCACGGCAGG - Intergenic
1184229525 22:43151327-43151349 CTCCTCCTCCCCATGGTGACCGG - Intergenic
1184309666 22:43633118-43633140 CTCCACCTCCCAGGCGAGCCGGG - Intronic
1184426123 22:44410264-44410286 CTCCATGCCCCCAGCCTGGCGGG - Intergenic
1184620432 22:45672267-45672289 CTCCGCGTCTCCAGCGAGGCGGG - Intronic
1203254491 22_KI270733v1_random:131679-131701 CTCCACCTCCCCGGCGCGGCGGG - Intergenic
1203262547 22_KI270733v1_random:176758-176780 CTCCACCTCCCCGGCGCGGCGGG - Intergenic
950654425 3:14427875-14427897 TTCCATCTCCCCAGCTTAGCAGG + Intronic
952377702 3:32781076-32781098 CTCCCCCACCCCAGCACGGCTGG + Intergenic
952644485 3:35639334-35639356 CGCCACCTCCCGGGTGTGGCGGG + Intronic
952741957 3:36742575-36742597 CTCCACCTCCTCAGCATAACTGG + Intergenic
954619405 3:51986974-51986996 CTACACCTCCCCAGGGGTGCGGG + Exonic
954699261 3:52442959-52442981 CTCCACCTCCACTCCTTGGCTGG - Intronic
956062927 3:65366498-65366520 CACCACCTCCCCAGCTTGGACGG - Intronic
960542987 3:118881334-118881356 TCCCACCTCCACAGTGTGGCAGG - Intergenic
960569668 3:119173452-119173474 CTCCCCCGCCTCAGCGAGGCAGG + Intronic
962241538 3:133754825-133754847 CTCCACCTCCCAAGTGCTGCTGG - Intronic
962704234 3:138027851-138027873 CTCATCCTACCCAGTGTGGCTGG - Intronic
962853929 3:139327870-139327892 CTCCTCCTACACAGAGTGGCAGG - Intronic
968503170 4:960522-960544 CTCCACGTCCACACAGTGGCCGG - Exonic
968522483 4:1040217-1040239 AGGCACCTCCCCAGCCTGGCAGG + Intergenic
968621416 4:1604965-1604987 CTCCACATCTCCTGCTTGGCAGG + Intergenic
968673107 4:1862819-1862841 CTCCCTCTCCCCAGGGCGGCAGG - Intergenic
969131869 4:4996087-4996109 CTCCCCCTCCACAGCCTGGCTGG + Intergenic
969714370 4:8861224-8861246 CTCCAGGGCCCCAGCGGGGCAGG + Intronic
970204494 4:13642610-13642632 CTCCACCTGCTCAGATTGGCAGG + Intergenic
976386162 4:84461129-84461151 CTCCACTTCCTCAGCTTAGCAGG - Intergenic
979856488 4:125639277-125639299 CTCCACCCACTCAGCCTGGCAGG - Intergenic
981033065 4:140145128-140145150 CTCCACCTCCCGAGCACGTCTGG - Intronic
981059381 4:140404956-140404978 CTCCACCTCCCCACCATGCCTGG - Intronic
982091372 4:151882867-151882889 ATTCACCTCCTCGGCGTGGCTGG - Intergenic
983661278 4:170132838-170132860 CTCCTCCTCCTCAGTGTGGAAGG + Intergenic
983786671 4:171740543-171740565 CTTCAGCACCCCAGTGTGGCTGG - Intergenic
986694043 5:10336421-10336443 CTCCACCTCCCCTAAGTAGCTGG - Intergenic
986947141 5:13036378-13036400 CTCCACTTCCCCAGAATGCCTGG - Intergenic
988904321 5:35770711-35770733 CTCCACCTCTCCTCTGTGGCTGG - Intronic
990761380 5:59133725-59133747 TTCCACCTCCCCATCCTTGCGGG + Intronic
994776345 5:104039700-104039722 CACCACCTCGCCAGTGTGGGTGG + Intergenic
995047824 5:107670767-107670789 CTACCCCTCCCCAGCTTGGTGGG - Exonic
996944839 5:129054706-129054728 CTCAACCTCCCCCGAGTAGCTGG - Intergenic
999629677 5:153557784-153557806 TTCCACCTCCACAGCTTGTCCGG + Intronic
1001877122 5:175211069-175211091 CTCCACCCACCCAGCATGGTCGG + Intergenic
1004140770 6:13014836-13014858 CTCCTCCTGCCCAGAGTCGCTGG - Intronic
1004495331 6:16157595-16157617 CTCCATCACCCCAGAGTGGCTGG + Intergenic
1006278230 6:33023003-33023025 GGCCACCTCCCCAGTGTGCCTGG + Intergenic
1006315974 6:33291970-33291992 CTTCACTGCCCCAGGGTGGCTGG + Exonic
1007644965 6:43372680-43372702 CTCTCCCGCCCCAGAGTGGCAGG + Intergenic
1008222671 6:48874696-48874718 CTCCTCCTCCTCAGTGTGGAAGG - Intergenic
1009631229 6:66203169-66203191 CTCCACCTGCTCAGCCTGTCAGG - Intergenic
1013257869 6:108407179-108407201 CTCCACCTCCCCAACCATGCCGG - Intronic
1013619944 6:111878413-111878435 CTCTTCCTCCCCAGCATGCCTGG - Intergenic
1014372394 6:120626819-120626841 CTCCAAGTCCCCAGGGAGGCAGG - Intergenic
1019461436 7:1160834-1160856 CTCCTCCTGCCCAGCTGGGCGGG - Intergenic
1019538758 7:1542004-1542026 CTCTGCCCTCCCAGCGTGGCTGG - Exonic
1019634067 7:2066255-2066277 CTCGACCACCCCAGCTGGGCGGG + Intronic
1020457550 7:8391254-8391276 CTGCAGGTCCCCAGCCTGGCTGG - Intergenic
1023279386 7:38554073-38554095 CTCCAATTCCCCTGCCTGGCTGG + Intronic
1023883553 7:44335127-44335149 CTCCACATCCCCAGCCTGGCAGG + Intergenic
1024578399 7:50782718-50782740 CGCCACCGCCCGAGCGTGCCCGG + Intronic
1026011296 7:66638569-66638591 CTGAATCTCCCCAGCGTGACTGG - Intronic
1026910809 7:74090746-74090768 GGCCACCTCCCCAGTGGGGCTGG - Intronic
1029614612 7:101648451-101648473 CTCCACTCCCCCAAGGTGGCAGG + Intergenic
1032326202 7:130930911-130930933 CCCCACTTCTCCATCGTGGCGGG + Intergenic
1033220942 7:139525811-139525833 TTCCTCCTCCCCACTGTGGCTGG + Intronic
1035243970 7:157550514-157550536 CCCCACCTGCCCTGCCTGGCTGG + Intronic
1035403409 7:158583469-158583491 CCCCACCTCCCCTCCCTGGCAGG + Intronic
1035455715 7:159007383-159007405 CCCGCCCTCCCCAGCGTGGCTGG - Intergenic
1037467157 8:19172017-19172039 CCCCGCCTCCCCAGCCTGCCTGG + Intergenic
1038455412 8:27669422-27669444 AGCCACCTCCCCACCCTGGCAGG - Intronic
1039473049 8:37825967-37825989 CTCCAAGGCCCCAGCATGGCTGG + Intronic
1040122835 8:43701538-43701560 CTCCTCCTCCTCAGTGTGGAAGG + Intergenic
1042397194 8:68306430-68306452 CTCCACCTCCCCAGCGTGGCAGG + Intronic
1045495029 8:102700854-102700876 CTCCTCCTCCCCAGCCTCCCAGG + Intergenic
1048340182 8:133532847-133532869 ATGCTCCTCCCCAGCGTGGAGGG + Intronic
1048532833 8:135265788-135265810 CTTAACCTCCCCAGCATGGCTGG - Intergenic
1048766204 8:137847203-137847225 CTCTAGCTCCCCAGTGTGGTGGG + Intergenic
1049218424 8:141418066-141418088 CACCTCCTCCCCGGCGGGGCTGG - Intronic
1049238104 8:141522825-141522847 CTCCAGCTCCCTATCGAGGCTGG - Intergenic
1049266011 8:141668308-141668330 CTCCAGGCCCCCAGCGTCGCAGG + Intergenic
1049564118 8:143329073-143329095 CTCCACATCCACAGCCTGCCTGG + Intronic
1049741352 8:144242533-144242555 CCCCAGCTCCCCTGCGTGGCAGG - Intronic
1053203268 9:36166682-36166704 CTCCAGCGCCACCGCGTGGCTGG + Intergenic
1057297620 9:93858679-93858701 CACCACCTCCCCCCCATGGCTGG - Intergenic
1058417843 9:104806400-104806422 CTCTTCCTCCCCTGCCTGGCAGG + Exonic
1059121514 9:111643215-111643237 CTCCATCTCACCAGCAAGGCTGG - Intronic
1061153893 9:128845629-128845651 CTCCACCTCCCCAACCTGCAGGG + Intronic
1061948190 9:133920500-133920522 CTCCACCTGCCCAGCTGGCCTGG + Intronic
1061974727 9:134062349-134062371 CTGCACCTGCCCAGCGTGTCTGG - Intronic
1062119376 9:134825921-134825943 CTCCATGGCCCCAGCGGGGCAGG + Intronic
1062169484 9:135127073-135127095 CTCCAGTCCCCCAGCCTGGCAGG + Intergenic
1062464818 9:136676305-136676327 CTCTACCTGCCCAGCCTCGCAGG + Intronic
1062721584 9:138047058-138047080 CTCCCCCGCCACAGCCTGGCGGG - Intronic
1203470892 Un_GL000220v1:114823-114845 CTCCACCTCCCCGGCGCGGCGGG - Intergenic
1203478713 Un_GL000220v1:158795-158817 CTCCACCTCCCCGGCGCGGCGGG - Intergenic
1186461947 X:9754771-9754793 CCCCACATCCCCACCGTGGGTGG + Intronic
1187716509 X:22107513-22107535 CTGCATCTCCCCAGTGTGGCTGG + Intronic
1190083780 X:47377544-47377566 CTCAACCTCCCAAGAGTAGCTGG + Intronic
1190329431 X:49226579-49226601 CACCCCCACCCCAGCCTGGCTGG + Intronic
1190626636 X:52343732-52343754 CTGCACCTACCCTGCTTGGCGGG - Intergenic
1190701375 X:52992097-52992119 CTGCACCTACCCTGCTTGGCGGG + Intronic
1192234862 X:69289323-69289345 CTCCACCTCCTCAGCCCTGCTGG - Intergenic
1194227541 X:91279717-91279739 CTCATCCTCCCCATCCTGGCTGG - Intergenic
1196462975 X:115948448-115948470 TACCACCTCCCGAGCTTGGCAGG - Intergenic
1197317882 X:124991124-124991146 CTCCTTCTCCCCAACATGGCAGG - Intergenic
1198000828 X:132433803-132433825 CTCAAGATCCCCAGCGTGGCTGG - Intronic
1199675903 X:150189220-150189242 CTCTACCTCCCCAGAGAGGCAGG + Intergenic
1200732885 Y:6761413-6761435 CTGCAGCTCCCCAGGCTGGCTGG + Intergenic
1200961003 Y:8996126-8996148 CTCCTCCTCCTCAGTGTGGAAGG - Intergenic
1200982891 Y:9278333-9278355 CTCCTCCTCCTCAGGGTGGAAGG + Intergenic