ID: 1042398185

View in Genome Browser
Species Human (GRCh38)
Location 8:68315173-68315195
Sequence ATGAATAAATATGAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 918
Summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 844}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042398185_1042398191 30 Left 1042398185 8:68315173-68315195 CCTTCTTCCTCATATTTATTCAT 0: 1
1: 0
2: 3
3: 70
4: 844
Right 1042398191 8:68315226-68315248 TTCCAGGCTGTATAACAGCTTGG No data
1042398185_1042398189 14 Left 1042398185 8:68315173-68315195 CCTTCTTCCTCATATTTATTCAT 0: 1
1: 0
2: 3
3: 70
4: 844
Right 1042398189 8:68315210-68315232 TTCCTAATACTCTTGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042398185 Original CRISPR ATGAATAAATATGAGGAAGA AGG (reversed) Intronic
900037049 1:422707-422729 GGGAATAAATATGAGCAAAATGG - Intergenic
900058679 1:658448-658470 GGGAATAAATATGAGCAAAATGG - Intergenic
901164224 1:7205429-7205451 ATGGATAGATATGAAGATGAAGG - Intronic
902102317 1:14001396-14001418 AAGAATAAATATCATGAAAATGG + Intergenic
903395294 1:22997435-22997457 AAGAGAAAATAGGAGGAAGAAGG - Intergenic
903584006 1:24394444-24394466 AAAAATTAATAGGAGGAAGAAGG + Intronic
904391050 1:30186365-30186387 ATGAATAAATAGGGGGTGGATGG - Intergenic
906014429 1:42561999-42562021 AAGAATCAATATCAGGAAAATGG + Intronic
907264910 1:53252068-53252090 ATAAATACATATGAGAAAGGAGG + Intronic
907745641 1:57210678-57210700 ATCAATAAATTTGATGAAAAAGG + Intronic
908612373 1:65876945-65876967 ATGAATCAATATCATGAAAATGG + Intronic
908856701 1:68438102-68438124 ATGTATAAACATGAGGCAGGAGG + Intronic
908891252 1:68850592-68850614 ATAAATAAATAGGAAGAATATGG - Intergenic
908942039 1:69446835-69446857 ATGAATCAATATCATGAAAATGG + Intergenic
909037775 1:70613999-70614021 ATGAATCAATATTGGGAAAATGG + Intergenic
909105609 1:71403134-71403156 ATGAACAGATATGGGAAAGAGGG + Exonic
909372416 1:74899286-74899308 ATGAATCAATATCATGAAAATGG - Intergenic
909434886 1:75629698-75629720 ATAAATACATATGAGAAAGAAGG + Intergenic
909775898 1:79484506-79484528 ATAAATAAATATTATGAAAAAGG + Intergenic
909837459 1:80275061-80275083 ATAAATAAATATTGGGAACAGGG - Intergenic
909867308 1:80689335-80689357 ATGAATATATGTGAAGAATAAGG - Intergenic
909949245 1:81700024-81700046 ATGCAGAGAAATGAGGAAGATGG + Intronic
910031217 1:82726201-82726223 AGACATAAATATGAGGAAGCCGG + Intergenic
910155998 1:84220168-84220190 AGGAATAAATTTGACCAAGAAGG - Intronic
910823795 1:91383479-91383501 TTGATTAAAAATGAGGGAGAGGG - Intronic
910829535 1:91446393-91446415 AAGAATCAATATCAGGAAAATGG + Intergenic
910856145 1:91697928-91697950 AGGAAAAAATATGAGCAAAAAGG + Intronic
910994186 1:93086508-93086530 AAAAAAAAAGATGAGGAAGAAGG + Intronic
910995017 1:93095312-93095334 ATGAAGAAATATGTAGAAGTTGG - Intronic
911122742 1:94312334-94312356 ACAAATAAAAATGAAGAAGAAGG - Intergenic
911226649 1:95314411-95314433 ATGAATGAATAAAAGGAAGGAGG + Intergenic
911286855 1:96005484-96005506 ATAAATAAGTAAAAGGAAGATGG - Intergenic
911720087 1:101181573-101181595 ATGAACAAATCTGAGGATTAAGG - Intergenic
912104195 1:106250115-106250137 ATGATTATATATGAGAAAGGAGG - Intergenic
912235175 1:107843555-107843577 ATATATATATATGAGGAAGGTGG + Intronic
912247216 1:107971962-107971984 ATGAATAAATTAGGTGAAGAGGG + Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
913136619 1:115896671-115896693 AGGAGTAAGAATGAGGAAGATGG - Intergenic
913301978 1:117381071-117381093 AGGAATAAATTTAATGAAGAAGG - Intronic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
913425225 1:118721311-118721333 AAGAATAAATATCATGAAAATGG + Intergenic
914617477 1:149373601-149373623 ATGACTACATTTAAGGAAGATGG - Intergenic
915019024 1:152762162-152762184 ATGCTTAAATATGGTGAAGATGG - Intronic
915041306 1:152970320-152970342 TTGAAGAAAAAAGAGGAAGAGGG - Intergenic
915211450 1:154312724-154312746 AAGAATAAAAATGATGAAGTAGG - Intergenic
915212564 1:154321418-154321440 AAGAATAAAAATGATGAAGTAGG - Intronic
915865871 1:159498524-159498546 ATGAAAAATTGTGGGGAAGAGGG - Intergenic
916661000 1:166922115-166922137 ATGATCAAAAATGAGGGAGATGG + Intronic
916910231 1:169338462-169338484 ATGAATATATAGCAGGAAGCTGG + Intronic
917041997 1:170815302-170815324 AAGAATAAATATCATGAAAATGG + Intergenic
917261007 1:173169389-173169411 TTGAATAAATATATGGTAGAGGG - Intergenic
917594874 1:176519051-176519073 ATGGAGGAAAATGAGGAAGATGG + Intronic
917694570 1:177508676-177508698 ATGAATAAATGAAAGAAAGAAGG + Intergenic
918809125 1:189092983-189093005 AGGAATAAATATCATGAAAATGG - Intergenic
919445515 1:197700003-197700025 AAGAATCAATATCATGAAGATGG + Intronic
919543521 1:198881305-198881327 ATAAATAAGTGTGAGGAGGAAGG - Intergenic
920325931 1:205163977-205163999 CTGAATAGTTGTGAGGAAGAAGG + Intronic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
920523888 1:206651177-206651199 ATGAATAAAGAAGAGGAGGATGG - Intronic
920778538 1:208965085-208965107 ATGAATAAATTTAATCAAGAAGG - Intergenic
921495889 1:215841087-215841109 AAGAATAAATATCATGAAAATGG + Intronic
921532565 1:216303088-216303110 ATCCATAAATAAGAGGAAGAAGG - Intronic
921561100 1:216659233-216659255 TTGTATAAATCTGAGGAAGGTGG - Intronic
922405820 1:225312044-225312066 AAGAATCAATATCAGGAAAATGG - Intronic
922624421 1:227023699-227023721 ATGCATACATATGATGGAGATGG + Intronic
922761666 1:228136151-228136173 AGGAAGAAAGAAGAGGAAGAAGG + Intergenic
923040273 1:230315048-230315070 ATGCTTAATTAGGAGGAAGAAGG - Intergenic
923128579 1:231055006-231055028 ACAAATAAATATTAGCAAGAAGG - Intergenic
923943314 1:238854145-238854167 AAGAATAAATATGGTGAAAATGG + Intergenic
924117874 1:240765384-240765406 ATGAATTAATATGTGGTAGCTGG - Intergenic
924142678 1:241042093-241042115 AAGAATAACTCTAAGGAAGAAGG + Intronic
924492924 1:244557446-244557468 AGGAATAAATTTGACCAAGAAGG - Intronic
1063258239 10:4353046-4353068 AAGAAAAGATAAGAGGAAGAAGG - Intergenic
1063276102 10:4569336-4569358 CTGAACAAATATGAGGAAGCAGG + Intergenic
1063782285 10:9339116-9339138 ATGTGTAGATATGTGGAAGATGG + Intergenic
1063942448 10:11144258-11144280 ATAAATCATTATGAGCAAGAGGG - Intronic
1065131955 10:22631154-22631176 ATTAAAAAATATTTGGAAGAGGG - Intronic
1065271983 10:24042659-24042681 ACCAATAATTATTAGGAAGATGG + Intronic
1065573438 10:27095674-27095696 ATAAATAAATAAGAGGAGGGAGG + Intronic
1065592966 10:27284366-27284388 ATGAATTGATATGAGCATGAAGG + Intergenic
1066697388 10:38091254-38091276 ATGAAGAAAGATGAGGAAAGTGG + Intergenic
1067709787 10:48638642-48638664 ATGAATAAATAGCATGGAGATGG - Intronic
1067972279 10:50986248-50986270 ATAAATAAATATAAGTAACATGG - Intergenic
1068213669 10:53954132-53954154 ATGATTAACTATGTGGAAGAAGG + Intronic
1068251381 10:54446486-54446508 ATAAAGAAATAAGAGGAAAAAGG - Intronic
1068453069 10:57218276-57218298 AAGAAGAAAGAAGAGGAAGAAGG + Intergenic
1070911277 10:80120614-80120636 ATGGATAAAAATGATCAAGATGG - Intergenic
1071218906 10:83440583-83440605 AAGAATCAATATCATGAAGATGG + Intergenic
1071441652 10:85703510-85703532 AAGATTAAGTAGGAGGAAGAAGG + Intronic
1071738592 10:88330604-88330626 ATGTATAATTATTAGAAAGAAGG + Intronic
1071748390 10:88447551-88447573 AAGAATCAATATCAGGAAAATGG + Intronic
1071759562 10:88585288-88585310 ATTAATAGAAATGAGGAAGCTGG - Intergenic
1072364965 10:94700020-94700042 AAGAATCAATATCATGAAGACGG + Intronic
1072410820 10:95200581-95200603 ATGAAGAAAGAAGAAGAAGAAGG + Intronic
1073259937 10:102182060-102182082 ATAAATAATTAAGAGGCAGAGGG - Intergenic
1073302739 10:102480894-102480916 AAAAAGGAATATGAGGAAGACGG - Exonic
1073934199 10:108611322-108611344 ATGAGTAAATATGATCAATACGG - Intergenic
1074414508 10:113255503-113255525 ATGAACAGATATTATGAAGAAGG - Intergenic
1074586353 10:114770821-114770843 ATAAATAAATATTAAAAAGAAGG - Intergenic
1074614183 10:115049928-115049950 TTTAATAAATAACAGGAAGATGG + Intergenic
1075966490 10:126616217-126616239 TTCAATAAATACGAGGCAGATGG - Intronic
1076963775 11:60629-60651 GGGAATAAATATGAGCAAAATGG - Intergenic
1077316977 11:1923701-1923723 GTGACTAATGATGAGGAAGATGG - Intronic
1077820448 11:5733095-5733117 AAGAATAAATATAAGTAAGTTGG - Intronic
1078041249 11:7865443-7865465 AAGAATCAATATGATGAAAATGG + Intergenic
1078213134 11:9287845-9287867 ATAAATCAATGTGAGTAAGACGG - Intronic
1078487965 11:11741471-11741493 ATGAATCAAGATGATGGAGATGG + Intergenic
1078635896 11:13049794-13049816 ATGAATAAATAAGTGGAGAAGGG - Intergenic
1078751597 11:14170093-14170115 AAGAATAAATATCATGAAAATGG - Intronic
1079664275 11:23084090-23084112 ATGAATCAATATCATGAAAATGG - Intergenic
1079777597 11:24552923-24552945 ATAAATAAATATGAAAATGAAGG + Intronic
1081230787 11:40583500-40583522 ACAAATAGAGATGAGGAAGATGG - Intronic
1081251931 11:40846756-40846778 AAGAATTAATATCAGGAAAATGG - Intronic
1081608234 11:44541077-44541099 ATAAGTAAATAAGATGAAGATGG + Intergenic
1082745451 11:56956237-56956259 AAGAATAAAAGGGAGGAAGAAGG + Intergenic
1083688915 11:64394714-64394736 GTGAAGAAATGTGAGGAGGAGGG + Intergenic
1085168012 11:74421589-74421611 ATGAAAATAAATGAGTAAGATGG - Intergenic
1085509262 11:77078792-77078814 AGGAATAAATATTACCAAGAAGG - Intronic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1086221582 11:84451589-84451611 ATAAATAAATAAGTGGAGGAGGG - Intronic
1086474258 11:87153575-87153597 ATGAATAACAATGAGGTAGAAGG - Intronic
1087676597 11:101169645-101169667 ATGAGAATGTATGAGGAAGAAGG + Intergenic
1087707854 11:101515134-101515156 TTGAATAATTATGATTAAGAAGG - Intronic
1087845660 11:102969668-102969690 ATGAATCAATATGGTGAAAATGG - Intergenic
1088043794 11:105422089-105422111 ATGGATTAATATCAGAAAGATGG - Intergenic
1088380657 11:109188984-109189006 AAGAATCAATATCAGGAAAATGG - Intergenic
1088613103 11:111598071-111598093 ATAAATAAATATGTGGAATGAGG - Intergenic
1088657067 11:112010346-112010368 AAGAATAAATATCATGAAAATGG + Intronic
1089037368 11:115408641-115408663 ATGAATAAGTACTAGGAGGAGGG - Intronic
1089067297 11:115671428-115671450 ATGAAGAAAAATGAGGAAGAGGG - Intergenic
1089098285 11:115937998-115938020 ATGATTAAATGTGAGGGAGTGGG + Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089336016 11:117724507-117724529 ATGAATAAAGAGTAGCAAGAGGG - Intronic
1089459056 11:118642133-118642155 AAGAAGAAAGAAGAGGAAGAAGG - Intronic
1089530237 11:119123205-119123227 ATGATTGAATCAGAGGAAGAGGG + Intronic
1089612926 11:119679647-119679669 CTGAATAAATGGGAGGAAGAGGG - Intronic
1089728147 11:120501034-120501056 CTGAATAAATATCAACAAGAAGG - Intergenic
1089831980 11:121336954-121336976 ATTAATCAAAAGGAGGAAGATGG - Intergenic
1089897341 11:121944290-121944312 ATAAATAAATATATGTAAGAAGG - Intergenic
1089940209 11:122408621-122408643 ATGAATAAAGATGTGAAGGAGGG - Intergenic
1089983775 11:122794173-122794195 ATAAATAAATTAGAGGTAGATGG - Intronic
1090523145 11:127500302-127500324 ATGATTAAATGTGGGGAGGAAGG + Intergenic
1090675819 11:128994801-128994823 ATGAATAAATATTCATAAGAAGG - Intronic
1090904221 11:131060128-131060150 GTGAATAAAAAGGAGGAATATGG + Intergenic
1091060402 11:132455750-132455772 ATGAATGAATTTGACAAAGAAGG - Intronic
1091094706 11:132809819-132809841 ATAAATAAACAAGAAGAAGATGG - Intronic
1091537388 12:1424646-1424668 ATGAAGAAACAAGAGGAAAAGGG - Intronic
1091538327 12:1435017-1435039 AAAAACAAACATGAGGAAGACGG - Intronic
1091554516 12:1562353-1562375 ATAAATAAAGATGAGGAAACAGG + Intronic
1092042345 12:5395771-5395793 AGGAAGAAACATGAGGAAGAAGG - Intergenic
1092311760 12:7364392-7364414 TTGAATAAATGTGAAGAAAATGG - Intronic
1092553410 12:9528436-9528458 ATGAATAAATAACCAGAAGATGG - Intergenic
1092884273 12:12911863-12911885 ATGAATAACTATGATGACTAGGG - Intronic
1092990714 12:13896234-13896256 ATGAGTAATAGTGAGGAAGATGG + Intronic
1093379528 12:18475885-18475907 ATAAATAAATTTTAGGAAGATGG + Intronic
1094056144 12:26271623-26271645 ATGAAGAAATAAGAAGAAAATGG + Intronic
1094086202 12:26594796-26594818 GTGAAGAAATATAAGAAAGAAGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094518689 12:31162187-31162209 ATGAATAAATAACCAGAAGATGG + Intergenic
1094539406 12:31350656-31350678 ATGAAAAGCTATGAGAAAGAAGG - Intergenic
1095732586 12:45521843-45521865 ATAAATAAATAAGAAGAAAAGGG - Intergenic
1096253163 12:50046317-50046339 ATGCATAAATAAGGGGAGGAAGG + Intergenic
1097349200 12:58529078-58529100 ATGAATAAATTTTAGCAAGTAGG - Intergenic
1097603441 12:61723401-61723423 ATGAATTAATATAAGGAAAAAGG + Intronic
1097669515 12:62519125-62519147 ATAAATAACCATGTGGAAGAGGG + Intronic
1097742027 12:63254223-63254245 GTGAATAAAGCTGAGGAATATGG - Intergenic
1098018319 12:66129959-66129981 TTGAATATATATGAGGGAGGAGG - Intronic
1098019714 12:66140908-66140930 AGGAATAAATATAAGAAAGATGG + Intronic
1098363688 12:69680190-69680212 ATGACTGAATAAGAGGAATAAGG + Intronic
1098594334 12:72254575-72254597 CTGAGTGAAGATGAGGAAGAAGG - Intronic
1098796257 12:74891958-74891980 ATGAATAAAAATAAAGAAGAAGG + Intergenic
1099441577 12:82706006-82706028 ATTAATAAAGATGAGAGAGAAGG + Intronic
1099735869 12:86565659-86565681 ACAAATAAATTTGGGGAAGAGGG + Intronic
1099813925 12:87621100-87621122 AGGAATAAATATGTGAGAGAAGG - Intergenic
1099906175 12:88773094-88773116 ATGCAAAGATATGAGGCAGAAGG + Intergenic
1100052495 12:90466149-90466171 AGGAATAAATTTAAGCAAGAAGG - Intergenic
1100108546 12:91208341-91208363 AAGAATAAATATCATGAAAATGG - Intergenic
1100368770 12:93945816-93945838 ATAAATAAATAAGAGTAGGAAGG - Intergenic
1100464081 12:94829905-94829927 ATAAATAAAATTGAAGAAGAAGG - Intergenic
1100917047 12:99435959-99435981 AGGAAAAAAAATGAGAAAGAAGG - Intronic
1101324846 12:103706513-103706535 ATGAAGAAAAATGAGAAAGGAGG - Intronic
1101565817 12:105904149-105904171 ATGAATAAAAGTGAGGAATGAGG + Intergenic
1101603219 12:106228300-106228322 ATGAAAAGATATCAGGAATATGG + Intergenic
1101628207 12:106467050-106467072 AAGAATCAATATCAGGAAAATGG - Intronic
1103142943 12:118566460-118566482 ATGAAGAAATAGGAGGATGTGGG + Intergenic
1104032613 12:125075954-125075976 ATCAATAAATATCGGGAAAAAGG + Intronic
1104351875 12:128051262-128051284 AAGAATAATAATGAAGAAGAGGG + Intergenic
1104436324 12:128759781-128759803 ATGTATAAAAATAAGGATGATGG - Intergenic
1105399421 13:20075523-20075545 ATGAAAATGTTTGAGGAAGAAGG + Intronic
1106344943 13:28867361-28867383 AAGAAAAAATATGGAGAAGAAGG + Intronic
1107557467 13:41529728-41529750 ATGATTAAATATCATGAAGATGG + Intergenic
1108031373 13:46233198-46233220 TTGAGTAGAAATGAGGAAGATGG - Intronic
1108367503 13:49730765-49730787 ATGAATAAATAGGGGGGAGGGGG - Intronic
1108704615 13:52973958-52973980 ATGAATAAAATTGAGGTAAACGG - Intergenic
1108730727 13:53232742-53232764 ATGATTAAAAATGAGGAAGGAGG + Intergenic
1108788996 13:53943400-53943422 ATGAACAGATCTGATGAAGAAGG + Intergenic
1108830312 13:54469571-54469593 ATGGAAAAATATTAGCAAGATGG - Intergenic
1108884898 13:55167561-55167583 ATGACTAAAAAAGAGAAAGAAGG + Intergenic
1109178781 13:59188239-59188261 ATGACAAAATTAGAGGAAGAAGG + Intergenic
1109757231 13:66776672-66776694 ATGAATCAATATCATGAAAATGG + Intronic
1109772784 13:66998648-66998670 CTGGCTAACTATGAGGAAGAGGG - Intronic
1110071682 13:71185676-71185698 AAGAATCAATATGATGAAAATGG + Intergenic
1110461046 13:75746172-75746194 GTTAATAAATATGAGACAGAAGG + Intronic
1110519743 13:76461486-76461508 ATGAATAAATATGTGTAAGCTGG + Intergenic
1111346215 13:86957952-86957974 AAGAATCAATATGATGAAAATGG + Intergenic
1111456863 13:88495887-88495909 GAGAATAAATATGAGGAAGGTGG + Intergenic
1111769685 13:92581356-92581378 ATGAATAAATATGGAGGATATGG - Intronic
1111808066 13:93063386-93063408 AAGAATAAATATCATGAAAATGG + Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112614980 13:100995104-100995126 AAGAATATATTTCAGGAAGAAGG + Intergenic
1112648423 13:101362693-101362715 TTGAATAAATCTGATGAAAATGG - Intronic
1112713456 13:102157050-102157072 AAGAATCAATATGACGAAAATGG + Intronic
1112946433 13:104933035-104933057 TTGAATAAAAATTATGAAGAGGG - Intergenic
1113211349 13:107985485-107985507 ATAAAAAAGTATGAGGAACATGG - Intergenic
1113408683 13:110064825-110064847 ATGAATAAATAAAAGTAAAAGGG - Intergenic
1114178726 14:20346954-20346976 ATCAATAATTATCAAGAAGATGG - Intronic
1114845294 14:26313440-26313462 AAGAATAAATATCATGAAAATGG + Intergenic
1114957477 14:27841983-27842005 ATAAAGAAATATAGGGAAGAAGG - Intergenic
1115009319 14:28524866-28524888 AAGAAGAAATAAGAAGAAGAAGG + Intergenic
1115190162 14:30739400-30739422 ATAAATAAATAAAAAGAAGAGGG - Intergenic
1115325919 14:32138093-32138115 AGGAATAAATTTGACCAAGAAGG - Intronic
1115377140 14:32689489-32689511 ATTAATAAATAAAAGGAATATGG - Intronic
1115608093 14:35025699-35025721 ATGAATAAATCTGAAGAAGATGG - Intronic
1115895711 14:38084608-38084630 ATGAGTAAATAAGAGTAAGCTGG + Intergenic
1116137381 14:40945344-40945366 ATGAAGAAATATGAGTTTGATGG - Intergenic
1116178069 14:41498773-41498795 ATTAATAAATATGATAAAAAAGG + Intergenic
1116236887 14:42289677-42289699 ATGAATAAATAATAAGAATATGG - Intergenic
1116252313 14:42501395-42501417 ATGAATCAATATCATGAAAATGG - Intergenic
1116432099 14:44857957-44857979 AAGAATCAATATCAGGAAAATGG + Intergenic
1116433414 14:44871958-44871980 AAGAATCAATATCAGGAAAATGG - Intergenic
1116596913 14:46860993-46861015 ATGAATAAAGAGGAAGAAAATGG - Intronic
1116611611 14:47080460-47080482 ATTAATAAATATTAAGAACATGG + Intronic
1116625708 14:47260227-47260249 ATGAATTAATATGTGAATGAGGG + Intronic
1116719343 14:48474402-48474424 AAGAATAAATAAGATGAAGCTGG - Intergenic
1116728458 14:48592277-48592299 ATGAATCAATATCATGAAAATGG + Intergenic
1116966933 14:51024783-51024805 AGGAAGAAAAAAGAGGAAGAAGG + Intronic
1117250349 14:53930361-53930383 ATGAATAAAACTGAAGAAGGTGG + Intergenic
1117380825 14:55161077-55161099 ATTAATAAATAAGAGGTAGTAGG + Intronic
1117822749 14:59667996-59668018 AAGAATCAATATGATGAAAATGG + Intronic
1118519656 14:66568565-66568587 ATGAAAAAGTATGAGTAAGCAGG + Intronic
1118666903 14:68080048-68080070 ATGAAGAAAGATGAGAAAAATGG + Intronic
1118717184 14:68568819-68568841 ATCAAAAAAGATGAGAAAGAAGG - Intronic
1118931205 14:70242720-70242742 AAGAATAAATATCATGAAGATGG - Intergenic
1119042050 14:71283535-71283557 GTGAATAGAAATGATGAAGATGG + Intergenic
1119851048 14:77866993-77867015 ATGAGTAAATAAGAGGAGGATGG - Intronic
1119979146 14:79059764-79059786 GTAGATGAATATGAGGAAGAGGG + Intronic
1120020533 14:79525101-79525123 ATGACTAGCTTTGAGGAAGAGGG + Intronic
1120025353 14:79577758-79577780 ATGAATAAATATGATGCTGGTGG + Intronic
1120079281 14:80197414-80197436 AGGAATAAATATTAGAATGATGG + Intergenic
1120281637 14:82446211-82446233 ATTTAAAAATATGAAGAAGAGGG - Intergenic
1120725174 14:87930865-87930887 AAGAATCAATATCATGAAGATGG + Intronic
1120784841 14:88523904-88523926 AGGAATAAATTTGACCAAGAAGG + Intronic
1120842736 14:89100376-89100398 AAGAATCAATATGATGAAAATGG - Intergenic
1121233812 14:92377864-92377886 CTGAATGAAGGTGAGGAAGAAGG + Intronic
1121301403 14:92874400-92874422 ATGAGAAAATCTGAGAAAGAAGG - Intergenic
1121746006 14:96293508-96293530 ATGAATAAATGTTTGGAGGAAGG + Intronic
1122491572 14:102119785-102119807 ATGCATAAAGAAGAGGAAAACGG - Intronic
1122492259 14:102126343-102126365 ACGCAAAAATATGAAGAAGATGG + Intronic
1123409846 15:20049167-20049189 ATCAATCAATATAAGTAAGAAGG - Intergenic
1123504285 15:20923864-20923886 ATTCATAAATCTGAGGAACATGG + Intergenic
1123519178 15:21055875-21055897 ATCAATCAATATAAGTAAGAAGG - Intergenic
1123561531 15:21497561-21497583 ATTCATAAATCTGAGGAACATGG + Intergenic
1123597775 15:21934841-21934863 ATTCATAAATCTGAGGAACATGG + Intergenic
1124074032 15:26425240-26425262 ATGAATAAATTTAACCAAGAAGG - Intergenic
1124112226 15:26801721-26801743 ATTAATCTAAATGAGGAAGAAGG + Intronic
1125010777 15:34871671-34871693 ATTAAGAAACATGAGGAAGGAGG - Intronic
1125101978 15:35924807-35924829 ATGAATAACTATGACCAAGAGGG - Intergenic
1125226393 15:37401063-37401085 AAGAATAAATATCATGAAAATGG - Intergenic
1125493367 15:40166151-40166173 ATGAAAAAATATGATGAATGAGG - Intronic
1125529112 15:40400072-40400094 ATAAATAAATGGGAGGGAGAAGG - Intergenic
1125617630 15:41029777-41029799 CTGAATAATTAGGAGGAAAAAGG + Intronic
1125932251 15:43608792-43608814 AAGAATAAATAGGAATAAGAAGG - Intronic
1125945348 15:43708264-43708286 AAGAATAAATAGGAATAAGAAGG - Intergenic
1126231519 15:46332213-46332235 ATGAAGAAATATGTGGCAAATGG + Intergenic
1126902353 15:53327280-53327302 ATTAATAAAAATGAAGAGGATGG + Intergenic
1126963211 15:54022082-54022104 ATGACTGAATATGAAGAAGTGGG + Intronic
1126992067 15:54389652-54389674 TTGAATAATTATGAGTAAAATGG - Intronic
1127170009 15:56291408-56291430 ATGAATAAATATAATAAATAGGG - Intronic
1127326521 15:57900845-57900867 AAGAATAAATATTATGAAAATGG - Intergenic
1127503176 15:59573577-59573599 ATGAACAAGGAAGAGGAAGAGGG + Intergenic
1127562511 15:60153277-60153299 TTGAATAACTATTAGGAACAAGG + Intergenic
1127713034 15:61620294-61620316 CTAAATAAATATTAGGAAGCTGG - Intergenic
1127716040 15:61650282-61650304 GTGAATTAATAGGATGAAGAGGG - Intergenic
1128406524 15:67346044-67346066 ATTAATAAAAAGGAGAAAGATGG + Intronic
1128597994 15:68970571-68970593 ATGAAAAAATATGAGGCAAGGGG + Intronic
1128774039 15:70305525-70305547 ATAAATAAATGAGAGGAAGGAGG - Intergenic
1129497771 15:76002454-76002476 ATGAGAAAATATCAGCAAGATGG + Intronic
1130618916 15:85440358-85440380 ATGAATAAATTCCAGGAAAAGGG - Intronic
1130874383 15:87999737-87999759 CTGAATTCAGATGAGGAAGATGG + Intronic
1131421684 15:92311643-92311665 ATCAATACATATGATGGAGATGG - Intergenic
1132295592 15:100731998-100732020 ATGAACAAGGATGAGGAACATGG + Intergenic
1132444780 15:101904546-101904568 GGGAATAAATATGAGCAAAATGG + Intergenic
1202969876 15_KI270727v1_random:224685-224707 ATTCATAAATCTGAGGAACATGG + Intergenic
1133583205 16:7166430-7166452 ATGAATAAATGTGATTCAGAGGG + Intronic
1133697784 16:8281345-8281367 ATCAATCAATATGTGTAAGATGG + Intergenic
1134197978 16:12173779-12173801 ATAAATAAATAAGAAGCAGAGGG - Intronic
1134556620 16:15171246-15171268 TTAAAAAAATAAGAGGAAGAGGG - Intergenic
1134917200 16:18082959-18082981 TTAAAAAAATAAGAGGAAGAGGG - Intergenic
1135432967 16:22402250-22402272 AAGAATAAAAATGAGGGGGATGG - Intronic
1136681497 16:31967542-31967564 AAGAATAAATATCATGAAAATGG + Intergenic
1136781806 16:32909049-32909071 AAGAATAAATATCATGAAAATGG + Intergenic
1136870961 16:33807865-33807887 ATCAATCAATATAAGTAAGAAGG + Intergenic
1136887989 16:33944804-33944826 AAGAATAAATATCATGAAAATGG - Intergenic
1137260902 16:46829297-46829319 AAGAATAAATATGGGGGAGGGGG + Intronic
1137845668 16:51685463-51685485 ATCAATAAAAATGAGGGACAGGG - Intergenic
1138734604 16:59235982-59236004 AGGAAGAAATATGAGGAAACTGG - Intergenic
1139712739 16:68789014-68789036 ATGAATAAATAAAAGAAAGTTGG + Intronic
1139931448 16:70530162-70530184 ATAAATAAATAAGAGAGAGATGG + Intronic
1140178167 16:72685959-72685981 ATGACTAAAAATGATTAAGATGG - Intergenic
1140605948 16:76537412-76537434 ATGTATGAAAATGAAGAAGATGG - Intronic
1140781931 16:78304938-78304960 AAGAAAAAAAAAGAGGAAGAAGG - Intronic
1140980656 16:80105698-80105720 ATGATCAAATATGAGGGAGGGGG + Intergenic
1141363643 16:83421239-83421261 AAGAATAAATATCCAGAAGAGGG + Intronic
1141525909 16:84611652-84611674 ATGAATAAACAGGAGAATGAAGG + Intronic
1141544147 16:84752462-84752484 AAGAATAAAAATGAGGAAGGCGG - Intronic
1203084460 16_KI270728v1_random:1173034-1173056 AAGAATAAATATCATGAAAATGG + Intergenic
1203101211 16_KI270728v1_random:1308193-1308215 ATCAATCAATATAAGTAAGAAGG - Intergenic
1142776757 17:2146388-2146410 ATGAACAGATATGAGTAAGTAGG + Intronic
1143173564 17:4944066-4944088 ATGCATAAATACAACGAAGACGG + Intronic
1143200521 17:5110186-5110208 ATGAAAAAAGAAGAGGAGGACGG - Intronic
1143246482 17:5490450-5490472 ATAAATAAATATTAGGTATAAGG - Exonic
1143533152 17:7517874-7517896 ATAAATAAATTTTAGGAAGTAGG + Intergenic
1144204113 17:12967090-12967112 AAAAAAAAAAATGAGGAAGAAGG - Intronic
1144289622 17:13813906-13813928 AGGAAGAAATGTGAGGAGGACGG + Intergenic
1144543892 17:16173980-16174002 AGGAATAAATATGACCAAGGAGG + Intronic
1144843933 17:18206115-18206137 ACAAATACAGATGAGGAAGAGGG - Intronic
1145085901 17:19939286-19939308 GGGAATAAATATGAGGATGCTGG - Intronic
1146243759 17:31258393-31258415 ATTGATAAATCTGAGGAACATGG - Exonic
1147355740 17:39894933-39894955 ATGAAACAAAAGGAGGAAGAAGG - Intergenic
1148518641 17:48246945-48246967 ATGAATGAATGTTAGAAAGAAGG + Intronic
1148889310 17:50796359-50796381 CTGGATAATTATGAGGAACAGGG + Intergenic
1149131812 17:53311285-53311307 ATAAATAAATAAAAGAAAGATGG + Intergenic
1150420125 17:65026587-65026609 ATCAAAAAATATGAAGCAGAGGG + Intronic
1150504038 17:65680507-65680529 GTGAATTAATGGGAGGAAGAAGG - Intronic
1150827073 17:68486358-68486380 AAGAAAGAATAAGAGGAAGAGGG - Intergenic
1151018256 17:70582654-70582676 AAGAAAAAATAGGAGGAGGAAGG - Intergenic
1151233042 17:72698639-72698661 ATGAATAAATAAAAGGAAAGTGG - Intronic
1151428790 17:74048788-74048810 ATGAATGAATGAAAGGAAGAAGG + Intergenic
1153095957 18:1403565-1403587 AGGAACAAATGGGAGGAAGATGG + Intergenic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1153243545 18:3052392-3052414 GTGAATAATTAAGAGGAAGATGG - Intergenic
1153645695 18:7194292-7194314 ATGCATAAATACAAGGAACATGG - Intergenic
1153725649 18:7951996-7952018 ATGAATAAAGATGAGAGTGATGG - Intronic
1154055412 18:11008656-11008678 ATAAATAGATATGCAGAAGATGG - Intronic
1154343014 18:13520015-13520037 ATGAATACACATGAAAAAGAGGG + Intronic
1155106688 18:22673948-22673970 AAGATGAAAAATGAGGAAGATGG + Intergenic
1155115544 18:22762927-22762949 AAGAATCAATATCAGGAAAATGG + Intergenic
1155283652 18:24266534-24266556 ATGAAGGAAAAAGAGGAAGAAGG + Intronic
1155842496 18:30663263-30663285 AAGAATAAATATCATGAAAATGG + Intergenic
1156006769 18:32451518-32451540 ATAATGGAATATGAGGAAGAGGG - Intronic
1156542072 18:37923563-37923585 ATTAAAAATTATCAGGAAGAAGG - Intergenic
1158337070 18:56423988-56424010 AACAAAAAAAATGAGGAAGAAGG + Intergenic
1158550791 18:58434193-58434215 AAGAATCAATATCAGGAAAATGG + Intergenic
1158650506 18:59280314-59280336 ATTTACAGATATGAGGAAGATGG - Intronic
1159128563 18:64253889-64253911 ATGTTTAAATATGAGCAAGAGGG - Intergenic
1159403907 18:67975395-67975417 ATGATCAAATATGACAAAGAAGG - Intergenic
1159508897 18:69370534-69370556 ATGATTGAATATGAGGACAACGG + Intergenic
1159760119 18:72415338-72415360 AAGAATGAATATGATGAAAATGG + Intergenic
1160253084 18:77221224-77221246 ATGAATAAATATGCAGATGGTGG - Intergenic
1160347870 18:78149716-78149738 ATGAATAAGCTTGAGGAAGGAGG - Intergenic
1160361109 18:78280046-78280068 ACCAATAACTATGATGAAGATGG - Intergenic
1160640578 19:130260-130282 GGGAATAAATATGAGCAAAATGG - Intergenic
1163061288 19:14763975-14763997 AGGAAGAAAAAGGAGGAAGAGGG - Intronic
1163502217 19:17683071-17683093 ATAAATAAATAGAAAGAAGAAGG + Intronic
1163744321 19:19035894-19035916 ATAAATGAATATGTGTAAGATGG + Intronic
1164404273 19:27928843-27928865 AGGTATCAATATGAGGAAGCAGG - Intergenic
1164965090 19:32476337-32476359 CTGAACTAAAATGAGGAAGATGG - Intronic
1167219880 19:48192107-48192129 ATAAATAAATATAAAAAAGAAGG - Intronic
1167604517 19:50474802-50474824 ATGAAAAAATATGACGTAAAGGG + Intronic
1168319842 19:55502345-55502367 AAGAAAAAAAATGAGAAAGATGG - Intronic
925644992 2:6026731-6026753 ATGAAAAAGTGTCAGGAAGATGG - Intergenic
925702126 2:6649227-6649249 ATGAAGAATGAGGAGGAAGAAGG - Intergenic
925961442 2:9020977-9020999 ATGAAAGAAAAGGAGGAAGAAGG - Intergenic
925963896 2:9044785-9044807 AAGAAAAAATATTAGGAAGATGG + Intergenic
926523586 2:13948163-13948185 ATGAAATAAATTGAGGAAGATGG - Intergenic
927017347 2:18978980-18979002 ATAAATAAATAAAAGGAGGAGGG - Intergenic
927038389 2:19204028-19204050 ATGAATAAAGAAGAGGTGGAGGG - Intergenic
927123094 2:19987303-19987325 AGAAATAAATATGAGGAATATGG - Intronic
927447626 2:23178429-23178451 ATGAATAAATATCTAGTAGATGG - Intergenic
927619012 2:24632346-24632368 GTGAACTAAAATGAGGAAGATGG + Intronic
928286674 2:29996035-29996057 ATGAGAAAAGAAGAGGAAGATGG + Intergenic
928497139 2:31844916-31844938 GTGAATAGATATGAGGAAGATGG - Intergenic
929022570 2:37568050-37568072 AAGAATAAAAATGAGGAAATAGG + Intergenic
929461888 2:42108364-42108386 ATGAAGAAAAAAGACGAAGAAGG - Intergenic
929676884 2:43943379-43943401 ATTAATAAATATAAGAAAAAAGG - Intronic
929766434 2:44847819-44847841 AAGAAGAAAGAGGAGGAAGAAGG - Intergenic
929767166 2:44854966-44854988 AAGCATAAATATGATGAAGTGGG + Intergenic
930526226 2:52533716-52533738 ATGAATAAATATGCGAGAAAGGG + Intergenic
930554894 2:52883292-52883314 ATGAGTGTATATGTGGAAGAGGG + Intergenic
930594931 2:53375778-53375800 ATGAATAAATGTCATTAAGATGG + Intergenic
930610513 2:53537916-53537938 ATAGAGAAATATGAGGAGGAAGG + Intronic
930976469 2:57468081-57468103 AAGAATAAATATCATGAAAATGG - Intergenic
931174760 2:59842636-59842658 ATGATTAAATATGAAGAAAAAGG + Intergenic
931182209 2:59914393-59914415 ATGAAAAAACAGGAGCAAGAAGG - Intergenic
931261860 2:60626984-60627006 ATGAATGAAGAGGGGGAAGAAGG + Intergenic
931413305 2:62056032-62056054 ATGATTACATATCAGGAAAACGG + Intronic
932964838 2:76460413-76460435 ATGAATATATTTGAGGAAACAGG - Intergenic
933465532 2:82646309-82646331 AAGAATAAATATCATGAAAATGG + Intergenic
933687655 2:85156146-85156168 ATGAACAATTATCACGAAGACGG - Intronic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934165507 2:89290493-89290515 AGGAAGAAATATGAGGAGGCAGG - Intergenic
934201768 2:89891969-89891991 AGGAAGAAATATGAGGAGGCAGG + Intergenic
934479809 2:94625880-94625902 ATAAAGAAATATAGGGAAGAAGG + Intergenic
935557772 2:104529018-104529040 AAGAATCAATATCATGAAGATGG + Intergenic
936172020 2:110185128-110185150 AAGAAGGAATATGAGGAAGACGG + Intronic
936547876 2:113408083-113408105 ATGAATAAAAAAAAGGAAAAGGG - Intergenic
937233085 2:120412338-120412360 AAGAATCAATATGATGAAAATGG - Intergenic
937500705 2:122475581-122475603 ATTAATAATTATGAGGACTACGG - Intergenic
937547012 2:123035527-123035549 GTGAATAAATCTCATGAAGAAGG - Intergenic
937592704 2:123633122-123633144 AAGAATAAATATCATGAAAATGG + Intergenic
937723301 2:125128429-125128451 AAGAATAAATATCATGAAAATGG + Intergenic
937943530 2:127310036-127310058 TTTAATAAATATGTGGGAGAGGG - Intronic
938221575 2:129573338-129573360 AAGAATCAATATCAGGAAAATGG + Intergenic
938484119 2:131686317-131686339 ATGAAGAAATCTGAAGAACAAGG - Intergenic
938816004 2:134904765-134904787 TGGACTAAATGTGAGGAAGAGGG + Intergenic
939701456 2:145397563-145397585 ATGATGAAATATTAGGAGGATGG + Intergenic
939772174 2:146334927-146334949 AAGAAAAAATATTAAGAAGAAGG - Intergenic
940570509 2:155427140-155427162 ATGAAGAAATAAGAGGACAAAGG + Intergenic
940755617 2:157678569-157678591 AAAAATAAATATAAAGAAGAGGG + Intergenic
940917095 2:159267716-159267738 ATGAATACGTATGGGAAAGAGGG - Intronic
940974018 2:159923493-159923515 ATGGATAAATATCTGGGAGAAGG + Intergenic
941155906 2:161977767-161977789 AGGAATAGATTTGAGGGAGAGGG - Intronic
941184217 2:162301142-162301164 ATGGGGAAATATGAGAAAGAAGG + Intronic
941201001 2:162510395-162510417 AAGAATACATATCAGAAAGAAGG + Intronic
941244266 2:163077819-163077841 ATGAATAAACATGAATAGGAGGG - Intergenic
941505539 2:166339431-166339453 ATGAAAAAATAGGAGGAGGGAGG + Intronic
941531984 2:166681759-166681781 ATGAATTAATATGAATAAGAAGG + Intergenic
941617349 2:167735875-167735897 ATGAATCCACATGATGAAGAAGG + Intergenic
941755757 2:169184023-169184045 TTAAATACATGTGAGGAAGATGG - Intronic
942336638 2:174894610-174894632 TTGAATAGATATGCGGAAGTCGG - Intronic
942485056 2:176430148-176430170 ATGAATAAATAAAATAAAGATGG + Intergenic
942679679 2:178463998-178464020 ATGAAGAAATATTGGGAGGAAGG + Exonic
942768950 2:179492100-179492122 GTGAATTAATTTGAGGGAGATGG - Intronic
942777913 2:179607193-179607215 ATCAATAAATGTGGGGAAGCAGG + Intronic
942964385 2:181873590-181873612 ATGAATAAATAATAAAAAGAGGG + Intergenic
943593433 2:189826915-189826937 ATTAATAAATATTATGAATAAGG - Intronic
943868909 2:192966781-192966803 ATGAATAAATTTGAGATAGGAGG + Intergenic
944654456 2:201864026-201864048 CTGAATAAATAAGAAGTAGATGG - Intronic
944768916 2:202893543-202893565 TTGAATAATTATGTGTAAGATGG - Intronic
945047035 2:205790725-205790747 ATGAATCAACAAGAGGAAGGTGG - Intronic
945061147 2:205910045-205910067 ATGAATAGATGTGAATAAGAAGG - Intergenic
945447766 2:209958489-209958511 ATGAATATATATGATGAGCAGGG - Intronic
945548914 2:211194553-211194575 ATGAATAAATTTTAGTAAGTAGG + Intergenic
945560055 2:211328852-211328874 ATGAATAAATATGAAGTTGTAGG - Intergenic
946515647 2:220408140-220408162 AAGAATAAATATGATTAAAATGG - Intergenic
947228299 2:227860646-227860668 CTGATAAAATATGAGGAAAAGGG + Intergenic
947356705 2:229303737-229303759 ATAAATAAATAAGAGGTAGGAGG - Intergenic
948286238 2:236787602-236787624 AAGAGAAAAAATGAGGAAGATGG - Intergenic
948392917 2:237625706-237625728 AGGCTTAAAGATGAGGAAGATGG + Intergenic
1169169256 20:3451145-3451167 ATAAATAAATATGAAAAACAGGG - Intergenic
1169306535 20:4495724-4495746 GGGAATAAAAGTGAGGAAGAGGG + Intergenic
1169569516 20:6890878-6890900 ATAAATAAATACCAGAAAGAAGG - Intergenic
1169780909 20:9309294-9309316 ATAAATACATTTCAGGAAGAGGG - Intronic
1169915869 20:10682639-10682661 ATGAATAAATATCAGGACCAAGG + Intergenic
1169957867 20:11125640-11125662 ATTAATAAGTAGGAGGAAGCTGG + Intergenic
1169992431 20:11518208-11518230 ATAACTAAATATAAGAAAGAAGG - Intergenic
1170239705 20:14150555-14150577 ATATAAAAATATTAGGAAGAAGG + Intronic
1170312613 20:15009055-15009077 ATGATTATATATGAGGCAGTTGG + Intronic
1170910292 20:20559711-20559733 ATGAGGAAATAGGAGGAGGAGGG + Intronic
1171567160 20:26205932-26205954 GTGAACAATTATGAGGAAGCAGG - Intergenic
1171988945 20:31680833-31680855 AAGAATAAATGTGAGAAAGGGGG + Intronic
1172298775 20:33833130-33833152 CTAAATCCATATGAGGAAGATGG - Intronic
1172393346 20:34581642-34581664 CTGGATAAACATGAAGAAGATGG + Exonic
1173059281 20:39646212-39646234 ATGAATTGAGGTGAGGAAGAAGG - Intergenic
1173121430 20:40293337-40293359 AGGAAAAAAACTGAGGAAGAGGG + Intergenic
1173422403 20:42914222-42914244 ATGACTAAGTATGAGGCAAAAGG + Intronic
1173596549 20:44262303-44262325 GTGAAAAAATATGAGAAAGATGG + Intronic
1174261201 20:49296605-49296627 ATGAATTAATATCAGGACCATGG - Intergenic
1175676463 20:60950341-60950363 ATGAATAAATGTGTGGATAAGGG + Intergenic
1176457073 21:6923211-6923233 ATGATAAAGTATGAGGAAGGGGG - Intergenic
1176835246 21:13788293-13788315 ATGATAAAGTATGAGGAAGGGGG - Intergenic
1177346825 21:19884027-19884049 ATGAATAAATATAAGCATGAGGG - Intergenic
1177409812 21:20715415-20715437 AAGAATAAATATGAACTAGAGGG + Intergenic
1178204069 21:30442708-30442730 CAGAATAAATATCATGAAGATGG - Intergenic
1179386177 21:40944478-40944500 AAGAATCAATATGATGAAAATGG + Intergenic
1179892170 21:44341320-44341342 ATCAATCAATATGTGTAAGATGG + Intergenic
1180894463 22:19319390-19319412 AAGTATAAAAATTAGGAAGAAGG - Intergenic
1182090383 22:27590703-27590725 ATGAATAAATGTGTGAATGAAGG + Intergenic
1182837755 22:33358100-33358122 AGGATTAAATATGAGGCAGCTGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183007419 22:34915032-34915054 TTGAATAATTCTGATGAAGAAGG - Intergenic
1184256501 22:43290028-43290050 GGGAATAAATGTAAGGAAGAAGG - Intronic
949119519 3:369194-369216 AAGAATAAATATCACGAAAATGG - Intronic
949835792 3:8268491-8268513 ATAAATAAATATGAGCATAATGG + Intergenic
950113394 3:10434906-10434928 AGGCCCAAATATGAGGAAGAGGG - Intronic
950243047 3:11388728-11388750 ATGAATAAAAAAAAGAAAGAAGG - Intronic
950962921 3:17124036-17124058 AAGAGGAAAGATGAGGAAGAAGG + Intergenic
951035584 3:17928353-17928375 AAGAATAAGTGTAAGGAAGAAGG + Intronic
951174526 3:19583687-19583709 AAGAATCAATATGATGAAAATGG + Intergenic
951799444 3:26578893-26578915 ATGAATATAAATGGGGAAGAGGG - Intergenic
951849925 3:27127903-27127925 ATAAATAAATTTCAGGAAGAGGG - Intronic
952490321 3:33865010-33865032 ATGATTAAATATGAGGCACCAGG + Intronic
952600538 3:35076116-35076138 AGGAATAAATTTGACCAAGAAGG + Intergenic
952710214 3:36423867-36423889 AAGAAGAAAGATGAGGAGGAAGG - Intronic
952929174 3:38346591-38346613 ATGAAGACATAAGATGAAGATGG + Intergenic
953537836 3:43789495-43789517 CTGAAAAAAAAAGAGGAAGAGGG - Intergenic
954008939 3:47617788-47617810 ATGTATAAATATTAGAAAGCAGG - Intronic
954836094 3:53469560-53469582 ATGAATCAATATCATGAAAATGG - Intergenic
954901306 3:54022307-54022329 ATGAAGAAATATGATGAGGCTGG + Intergenic
955592498 3:60552661-60552683 ATGAATACTTATCAGGAAGAGGG - Intronic
956226743 3:66968666-66968688 CTGAAGAAATATAAGGAATAGGG - Intergenic
956545453 3:70396089-70396111 AGGATTAAACATGAGGATGAAGG + Intergenic
957111194 3:75960376-75960398 GTGAACAATTATGAGGAAGCAGG + Intronic
957171554 3:76743803-76743825 ATTAATTAAAATGAGGGAGAGGG + Intronic
957466357 3:80598120-80598142 AAGAATAAATATCATGAAAATGG + Intergenic
957650485 3:82996476-82996498 AAGAATAAATATCATGAAAATGG + Intergenic
957797494 3:85030642-85030664 ATATATAAATATAAGTAAGATGG - Intronic
957860202 3:85938437-85938459 ATGAATCAAAAAGTGGAAGAGGG + Intronic
958765092 3:98358275-98358297 ATGAACAATTAAGAGAAAGATGG - Intergenic
958810110 3:98851480-98851502 AAGAATCAATATCAGGAAAATGG + Intronic
958881239 3:99673296-99673318 ATGCCAAAATGTGAGGAAGAGGG + Intronic
959403726 3:105935153-105935175 ATAAACAAAGATGAGTAAGATGG - Intergenic
959906952 3:111720973-111720995 ATGATGAAGTAAGAGGAAGATGG + Intronic
960178309 3:114543898-114543920 ATGAAAAAATCTCAGGAAGTAGG + Intronic
960252961 3:115477088-115477110 ATTAAGGAAAATGAGGAAGAGGG + Intergenic
960265128 3:115612766-115612788 AAGAATCAATATGATGAAAATGG - Intergenic
960368870 3:116809564-116809586 ATGAATAAATAGGTGGTAGTGGG + Intronic
960793453 3:121458409-121458431 ATAAATAAATAAAAGGAAGTCGG + Intronic
962095537 3:132288907-132288929 ATGAATGAATATGAGGCAATAGG + Intergenic
962130651 3:132670660-132670682 ATGAATAAAAATGTGAAAGCTGG + Intronic
962470896 3:135707541-135707563 ATAAATAAATAAGAGGACGTGGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963569618 3:146976533-146976555 ATAAAATAATATGTGGAAGATGG - Intergenic
963713538 3:148776048-148776070 ATGAAACAATATTAAGAAGAGGG + Intergenic
963769558 3:149376370-149376392 ATGCTTAAATTTGAGGCAGACGG + Intronic
963879270 3:150510206-150510228 AGGAATAAATTTGAGCAAGGAGG + Intergenic
963896707 3:150694107-150694129 AAGAAAAAATAGGAGGAGGAAGG - Intronic
964922300 3:161912007-161912029 AGTTATACATATGAGGAAGAGGG + Intergenic
964927074 3:161972711-161972733 GTGACTAATTATTAGGAAGAGGG + Intergenic
964950181 3:162281562-162281584 AAGAATAAATATCATGAAAATGG - Intergenic
965149624 3:164953172-164953194 ATAAATAAATAACTGGAAGAAGG - Intergenic
965352532 3:167631495-167631517 ATGAATAAATTTTAGGAAGTAGG + Intronic
965514365 3:169604898-169604920 ATGAAGACATGTGAGGAAAAGGG - Intronic
965613161 3:170565814-170565836 ATGAAGAAACAAGTGGAAGAGGG + Intronic
965800889 3:172492847-172492869 AAGAATGAATATGATGAAAATGG - Intergenic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966073947 3:175913195-175913217 ATGAATACATATGAAGAAGGAGG + Intergenic
966172906 3:177102305-177102327 GTGAATAAATATGTGAAAAATGG + Intronic
966471685 3:180296620-180296642 ATTAAGAAATATGTGGCAGATGG + Intergenic
966621492 3:181969141-181969163 AGGGATAAAGATGAAGAAGATGG + Intergenic
966708638 3:182947237-182947259 ATGTCTAATTATGATGAAGAAGG - Exonic
967568278 3:190997015-190997037 ATTGATAAATAAGAGGAAGAGGG - Intergenic
967796000 3:193599380-193599402 AAGAATAAAAAAGAGAAAGAAGG - Intronic
968021566 3:195395884-195395906 ATGAATAGATAAGAGAATGAAGG - Intronic
968169329 3:196496846-196496868 AAGAATAAATATACGGAGGACGG + Intronic
968223963 3:196960898-196960920 AAGAATATATATCAGGCAGAAGG + Intronic
968914192 4:3490033-3490055 ATTAATGAGTAGGAGGAAGAAGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
968914509 4:3491536-3491558 ATGAATGAATAGGTGGGAGAAGG - Intronic
969115961 4:4871042-4871064 ATGAATTAATTTAAGGAAGCTGG - Intergenic
970295146 4:14621306-14621328 ATGAAGAAATGTGAAGAAAAAGG + Intergenic
971179910 4:24319897-24319919 AGCAACAAATATGAAGAAGAAGG - Intergenic
971658168 4:29376888-29376910 AAGAATTAATCTGAAGAAGAGGG - Intergenic
971739025 4:30497075-30497097 ATGGATAAATGTGGGGAAGGGGG + Intergenic
971847579 4:31940282-31940304 AGGAAAAAATATGAAGAAAACGG - Intergenic
971886134 4:32450603-32450625 ATCAATACCTTTGAGGAAGATGG - Intergenic
971913422 4:32826564-32826586 ATGTATAAAAATGAGGTAAAAGG - Intergenic
972055929 4:34803684-34803706 ATGACTAAATTTGGGAAAGATGG + Intergenic
972619133 4:40730025-40730047 TTGAATAAAAAAGAAGAAGAGGG + Intergenic
972735063 4:41832416-41832438 TTCCATACATATGAGGAAGAGGG + Intergenic
972859714 4:43152560-43152582 AAGAATCAATATGATGAAAATGG + Intergenic
972866515 4:43239897-43239919 GAGAATAAAGAAGAGGAAGAAGG + Intergenic
973167212 4:47092532-47092554 ATGAATAAATAAAGGAAAGAAGG + Intronic
973239759 4:47945027-47945049 ATGAATAATTAGGAGGTTGAGGG + Intronic
973295192 4:48511223-48511245 ATGAAAAAATCTCAGGAATAGGG - Intronic
973599402 4:52526731-52526753 AAGAATAAATATCATGAAAATGG + Intergenic
973777152 4:54254184-54254206 ATGAAGAAAAATGGGAAAGATGG - Intronic
974265060 4:59576422-59576444 TTGATTAAATATTAGGAATAAGG + Intergenic
974388814 4:61237508-61237530 ATGAGTGAATCTGAGAAAGAAGG + Intronic
974442382 4:61936745-61936767 ATGTACAAATATGGGAAAGAGGG - Intronic
974503599 4:62737929-62737951 AAGAATAAATATCATGAAAATGG + Intergenic
974577745 4:63749804-63749826 ATGCATAAATATTATGCAGAAGG + Intergenic
974953426 4:68608620-68608642 AAGAATAAATATCATGAAAATGG - Intronic
974988380 4:69057518-69057540 ATGGATAAATATCCAGAAGAGGG - Intronic
975099105 4:70491728-70491750 AGAAAGAAATATGAGGAAGCAGG + Intergenic
975340887 4:73238647-73238669 ATACATAAATTTGAGTAAGACGG + Intronic
975501145 4:75086318-75086340 AAGAATCAATATCATGAAGATGG - Intergenic
976111305 4:81676840-81676862 CAATATAAATATGAGGAAGAAGG - Intronic
976358336 4:84147258-84147280 ATAAAATAATATGAGGAAAAGGG + Intergenic
977047295 4:92083505-92083527 AAGAATAAATATGGTGAAAATGG + Intergenic
977076664 4:92460982-92461004 ATAGATACATATGAGGAAGAAGG - Intronic
977143645 4:93407870-93407892 AAAAATAAAAATGAAGAAGAAGG - Intronic
977269510 4:94898814-94898836 ATTAATAAATTTGAGAGAGAGGG - Intronic
977700162 4:100012876-100012898 AAAAATAAAGAAGAGGAAGAAGG - Intergenic
977953946 4:103005339-103005361 ATGAAAAAAGATGACAAAGAAGG + Intronic
978120573 4:105074375-105074397 ATAAAAAATTATGAGGAAGAAGG - Intergenic
978312462 4:107399653-107399675 ATGATTTAATAAGAGGAACAAGG - Intergenic
978422100 4:108543739-108543761 ATGAACATAAATGAGGAAGGAGG + Intergenic
979632055 4:122914182-122914204 AGGAATAAATATGTGTAACATGG + Intronic
979823879 4:125208689-125208711 ATGAAGAAGTATAAGAAAGAGGG + Intergenic
979838719 4:125408512-125408534 GTGAATGAAGATGATGAAGATGG + Exonic
979877640 4:125913346-125913368 ATAAATCATTAAGAGGAAGATGG + Intergenic
979929502 4:126612859-126612881 ATGATTAAATAGGAGCAAGGAGG - Intergenic
980269681 4:130567912-130567934 AAGAGAAAATAGGAGGAAGAAGG + Intergenic
980948152 4:139343945-139343967 CACAATAAATATGGGGAAGAAGG - Intronic
981184242 4:141782297-141782319 GTGAATAAAGCTTAGGAAGATGG + Intergenic
981220303 4:142224632-142224654 ATTATTATATATGAAGAAGATGG - Intronic
981342776 4:143641263-143641285 ATTCATAGATATGAGGAAAAGGG + Intronic
981850332 4:149222001-149222023 TTGAAAAAAAATGGGGAAGAGGG + Intergenic
981861061 4:149356843-149356865 AAGAATCAATATGATGAAAATGG - Intergenic
982222562 4:153137531-153137553 ATGTTTCAATATGAGAAAGAGGG + Intergenic
982446135 4:155492522-155492544 ATGAAGACATAGAAGGAAGATGG + Intergenic
982878649 4:160681418-160681440 ATGAAAAAATCTGAGAAAGAAGG - Intergenic
982937606 4:161502997-161503019 ATGAGAAAATATGACAAAGAGGG + Intronic
982983955 4:162180213-162180235 ATGAATAAATATATGTAAAATGG + Intergenic
983051761 4:163056248-163056270 AAGAATAAATATCATGAAAATGG - Intergenic
983139340 4:164129212-164129234 ATGATTAAGAAGGAGGAAGAAGG + Intronic
983476835 4:168222299-168222321 CTGAATAAAAAGGAGGAAGAAGG + Intronic
983647666 4:170008221-170008243 GGGAATAAAAATGAGGAAGAGGG - Intronic
983711672 4:170724529-170724551 ATGCTTAAATAGTAGGAAGAAGG - Intergenic
983813053 4:172088292-172088314 TGTAATAAATATGATGAAGAGGG - Intronic
983861592 4:172713819-172713841 ATTAGTAAAGATGAGAAAGAAGG - Intronic
984588853 4:181594188-181594210 ATGAATAAGCATGATGAATAAGG + Intergenic
987468165 5:18296769-18296791 ATTAATTTACATGAGGAAGAGGG - Intergenic
987866691 5:23549920-23549942 ATGATCAACCATGAGGAAGAGGG - Intergenic
988095552 5:26604610-26604632 ATGAAAAAATATTAGCAAAAAGG - Intergenic
988179513 5:27772008-27772030 ATCAATAAAAATGTGGAAAATGG + Intergenic
988222546 5:28367931-28367953 ATGAAGAAAAAAGAGAAAGAAGG - Intergenic
988268645 5:28985333-28985355 AAGAATAAATATCATGAAAATGG + Intergenic
988344129 5:30014756-30014778 GAGAAAAAATAGGAGGAAGAGGG - Intergenic
988806244 5:34743377-34743399 ATGCAGAGACATGAGGAAGAAGG - Intronic
989207765 5:38828459-38828481 AAGAAATAATATGAGGAAGAAGG + Intergenic
989341794 5:40384432-40384454 CTGATTAAATATGAGGAGAAGGG + Intergenic
989371562 5:40715456-40715478 ATTGATAAATATGAGAATGATGG - Exonic
989408921 5:41094756-41094778 CTAAATAAATATGAGGAAAGAGG - Intergenic
989545398 5:42666869-42666891 ATCAATAACTGTGAGGAATAAGG + Intronic
989616790 5:43344838-43344860 ATGAATCAATATCATGAAAATGG + Intergenic
989661996 5:43809771-43809793 AAGAATCAATATCATGAAGATGG - Intergenic
989953465 5:50329417-50329439 ATAAATAAAAATAAGGATGATGG - Intergenic
990516981 5:56539418-56539440 TTGAATAAATGAGAGGAAGGAGG - Intronic
990540869 5:56771319-56771341 ATGAATAAAGATAAGGGATAAGG + Intergenic
990559695 5:56971571-56971593 ATGCAAAAATAAGAGAAAGAAGG - Intronic
990606624 5:57417024-57417046 ATGAATGAATGATAGGAAGATGG + Intergenic
990776593 5:59311533-59311555 AAGAAAAAAGATGAAGAAGAAGG + Intronic
991076873 5:62549901-62549923 ATCAATAAATTGGAGGAAAAAGG - Intronic
991096320 5:62743733-62743755 CTGTATAAATATGAGAGAGAAGG - Intergenic
991312853 5:65263851-65263873 ATGAATAACAATAAGGAACATGG + Intronic
991485718 5:67134458-67134480 ATGAATTAAAATGAGCAAGATGG - Intronic
992036185 5:72779966-72779988 TTGAATAAATATGATGAAAGTGG - Intergenic
992240407 5:74763940-74763962 CTGATTAAATATGAGAAATATGG + Intronic
993116808 5:83728990-83729012 ATGAATACATATGGTGACGAGGG - Intergenic
993366193 5:87036512-87036534 ATGAAAAAAGAAAAGGAAGATGG - Intergenic
993573609 5:89573299-89573321 ATGAATAAATTTTAAGAAGTAGG - Intergenic
993630612 5:90281835-90281857 ATAAATAAATAAAATGAAGAAGG - Intergenic
994403129 5:99307990-99308012 ATCAAAAAATATGAGAAAAAAGG - Intergenic
994704104 5:103178834-103178856 AGGAATTAATATGACAAAGATGG - Intronic
994832186 5:104798835-104798857 TTGAAGAAAAAAGAGGAAGATGG - Intergenic
994937575 5:106274281-106274303 CTGAATAGCTATGAGGAAGCAGG + Intergenic
995171026 5:109112306-109112328 AGGAATAAATAGGTTGAAGAAGG + Intronic
995309708 5:110696840-110696862 AAGAATCAATATCATGAAGATGG + Intronic
995420097 5:111955000-111955022 ATGAAGATGCATGAGGAAGAAGG + Intronic
995703402 5:114960199-114960221 AAGAGAACATATGAGGAAGATGG - Intergenic
995704093 5:114967838-114967860 ATCATTAATTATCAGGAAGATGG + Intergenic
995755671 5:115501403-115501425 ATAAATAGATATGAGGAGAAAGG - Intergenic
996174103 5:120333288-120333310 AACAATAAAAAGGAGGAAGAAGG - Intergenic
996412997 5:123179399-123179421 ATGGATAAATATTTGGAGGAGGG + Intronic
996468204 5:123827607-123827629 AAGAATAAAAAAGAGAAAGAAGG + Intergenic
996658736 5:125973191-125973213 ATGAATATATATGGGGACGAAGG - Intergenic
996800713 5:127399778-127399800 ATGAAGAAGTATGCAGAAGAAGG - Intronic
997543816 5:134688559-134688581 ATGAATAAATGGGAAGAAGGGGG - Intronic
997786806 5:136721028-136721050 AAAAATAAATAAGAGGCAGATGG + Intergenic
997867560 5:137478185-137478207 ATGGATAAACACGAGGAAAATGG + Intronic
998305004 5:141066642-141066664 ATAAAAAAATAAGAGGCAGATGG + Intergenic
998361190 5:141589191-141589213 AAGAATAAGCATGAGAAAGAAGG + Intronic
998563879 5:143198619-143198641 ATACAGAAATATGAGGTAGAGGG - Intronic
998566092 5:143217167-143217189 ATGAATAAGGAAGAGGAAAAGGG + Intronic
998683632 5:144499326-144499348 AAGAATAAATATCATGAACATGG + Intergenic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
998979470 5:147685622-147685644 ATCAATAAATAGTAAGAAGATGG - Intronic
999039453 5:148390882-148390904 AGGAAGAAAAAGGAGGAAGAAGG + Intronic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
1000463888 5:161551864-161551886 ATGAATCAATATGGTGAAAATGG - Intronic
1000673703 5:164093861-164093883 AAGAGAAAAAATGAGGAAGAGGG - Intergenic
1000728936 5:164806378-164806400 ATTACTAAATATGAGGTAGGAGG - Intergenic
1000902253 5:166925401-166925423 AAGAATAAATATGAGGACAATGG + Intergenic
1001511535 5:172326217-172326239 GTGAATAAATATGAGGAATCTGG - Intronic
1001878929 5:175225960-175225982 AGGAATGAATAGGAGGTAGATGG + Intergenic
1002736772 5:181396159-181396181 GGGAATAAATATGAGCAAAATGG + Intergenic
1002747927 6:78663-78685 GGGAATAAATATGAGCAAAATGG - Intergenic
1002834861 6:857511-857533 ATGGATAAATGAGAGGAGGATGG - Intergenic
1002920760 6:1570898-1570920 ATGATTATATAAGAAGAAGAGGG - Intergenic
1002938938 6:1699265-1699287 AAGAAGAAAAATAAGGAAGATGG + Intronic
1003172023 6:3727351-3727373 ATGAGTGAATCTGTGGAAGATGG - Intronic
1003480244 6:6524596-6524618 ATAAATAAATAACAGGCAGATGG + Intergenic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1004448048 6:15719809-15719831 AAGAAAAAATATGAAAAAGAAGG - Intergenic
1004485945 6:16066630-16066652 AAGAAGAAATATGAGCAACAGGG + Intergenic
1004991924 6:21147738-21147760 ATGAAGCAACGTGAGGAAGAAGG + Intronic
1005118089 6:22360502-22360524 ATGAATGAATATTTGGAAAAAGG + Intergenic
1005171404 6:22989403-22989425 AAGAATCAATATAATGAAGATGG - Intergenic
1005289631 6:24366579-24366601 ATGAATTAATCTGAGCATGAAGG + Intergenic
1007035390 6:38668254-38668276 ATAAATAAAAATAAAGAAGAGGG + Intergenic
1007815226 6:44518344-44518366 ATGAATAAATTTAAGCAAGGAGG - Intergenic
1008423947 6:51334621-51334643 ATTAAAGAAGATGAGGAAGAAGG - Intergenic
1008666134 6:53718325-53718347 TTGTATAAAAATGGGGAAGATGG + Intergenic
1009263332 6:61523784-61523806 AAGAATCAATATCAGGAAAATGG + Intergenic
1009659081 6:66586739-66586761 ATAAATATCAATGAGGAAGATGG + Intergenic
1009771475 6:68147991-68148013 ATGAATAAAAACTTGGAAGATGG + Intergenic
1010106465 6:72175298-72175320 AAGAATAAATATAAGCATGAAGG - Intronic
1010140901 6:72613486-72613508 AAGATTAAAAATGAGAAAGAAGG - Intergenic
1010596111 6:77766374-77766396 ATGGATAAATCTGAAGATGATGG + Intronic
1011047613 6:83103033-83103055 AGGGATAAAAATGTGGAAGAAGG - Intronic
1011062608 6:83288753-83288775 AAGAATAAATATCATGAAAATGG - Intronic
1011175678 6:84557652-84557674 ATGTTTAAATTTGAGGTAGAAGG - Intergenic
1011582117 6:88880204-88880226 ATGAATGAATGAAAGGAAGAAGG + Intronic
1012171151 6:96017443-96017465 ATGAATGAATATGAGCAAGGGGG + Intronic
1012633442 6:101503349-101503371 ATGAATAGAAAGGAGGAAGAAGG + Intronic
1012716220 6:102674428-102674450 ATCAAAAAATATGAGGCATATGG + Intergenic
1012817992 6:104048761-104048783 ATGTTTAAGTATGAGGGAGAAGG - Intergenic
1012889437 6:104881846-104881868 ATGTATAAATATGGGGGAGATGG - Intergenic
1013865377 6:114690210-114690232 ATGAAGACATAGGAAGAAGATGG - Intergenic
1014571136 6:123009527-123009549 GTGAAGATATATGAGGAAGTAGG - Intronic
1014905568 6:127022920-127022942 AGAAATAAATATGAGCAAAAAGG + Intergenic
1014952990 6:127581112-127581134 ATGACTAAATTTCAGGGAGAAGG + Intronic
1015065629 6:129023095-129023117 ATGAATGAATATGAGGCAGCAGG - Intronic
1015570608 6:134617756-134617778 ATAAATAAATAAGAGAAAGGAGG + Intergenic
1015659718 6:135561846-135561868 AAGAATAAATATCATGAAAATGG - Intergenic
1016876148 6:148867451-148867473 AATAATAAATATCAAGAAGAAGG - Intronic
1017119644 6:151012111-151012133 ATGAAACAATGTGAGGCAGAAGG - Intronic
1017275724 6:152565717-152565739 CTGAAAAAATAAGAGGGAGATGG + Intronic
1017280204 6:152615321-152615343 ATTTATAAATATTTGGAAGACGG - Intronic
1017849727 6:158294704-158294726 AAGAAGAAAAAAGAGGAAGAAGG - Intronic
1018210610 6:161477558-161477580 ATGAATCAAGGTGATGAAGATGG + Intronic
1018382860 6:163275280-163275302 ACAAAAAAATAAGAGGAAGAAGG - Intronic
1018875930 6:167822628-167822650 GTGACTAAATATTAGGAACACGG + Intergenic
1019241871 6:170671688-170671710 GGGAATAAATATGAGCAAAATGG + Intergenic
1019860237 7:3651994-3652016 ATGAATGAGTTTGAGGAAGAAGG + Intronic
1020427336 7:8083502-8083524 ATGAACAAATGGGAGGAAGGAGG - Intronic
1020829308 7:13074106-13074128 ATGAATAAATATGATCACAAAGG - Intergenic
1020940989 7:14537094-14537116 AAGAATAAATATAACCAAGAAGG + Intronic
1020993312 7:15229968-15229990 ATGAATTAAAATGAGAAATATGG - Intronic
1021492421 7:21233628-21233650 AAGAATAAATATTATGAAAATGG - Intergenic
1021739033 7:23666959-23666981 GTGAATAAAGATGAGAAAAATGG - Intergenic
1022324873 7:29322109-29322131 ATGAAGTAATATGAGGTAAAGGG + Intronic
1022405902 7:30089608-30089630 ATGAGCAAATGTAAGGAAGATGG + Intronic
1022567874 7:31421705-31421727 ATGTATAAATATCAGTAATATGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022669602 7:32443465-32443487 AAGAATAAATATCACTAAGATGG + Intergenic
1023130850 7:37001602-37001624 CTGAATAAATAAAAGGGAGATGG + Intronic
1023479501 7:40618255-40618277 ATAAATAAAGATGCAGAAGACGG - Intronic
1023759616 7:43452533-43452555 ATGAATGAATATCAGCAATAAGG - Intronic
1024502675 7:50129607-50129629 AAGAAGAAATATGAAGAAAAAGG + Intronic
1024822292 7:53346740-53346762 ATAAAAAAATAAGAAGAAGAAGG - Intergenic
1025287906 7:57683398-57683420 ATAAATAAATAAAAGAAAGAAGG - Intergenic
1026130451 7:67616394-67616416 ATGAAAAACAGTGAGGAAGATGG + Intergenic
1027398103 7:77777949-77777971 AGAAGTAAATATGAGGAAAAGGG - Intronic
1027490927 7:78825262-78825284 ATAAATAAATACAAGAAAGAAGG + Intronic
1027603671 7:80272125-80272147 AAGAAGAAATTAGAGGAAGAAGG + Intergenic
1027628384 7:80572270-80572292 AGGAATAAATATGACCAAGGAGG - Intronic
1027837562 7:83264606-83264628 ATGAATACAAATGAAAAAGAAGG + Intergenic
1028000338 7:85488685-85488707 AGGAATAAATATAACCAAGAAGG - Intergenic
1028095998 7:86761712-86761734 ATGAACAAAAATGATAAAGAAGG - Intronic
1028627547 7:92894327-92894349 AAGAATAAATATCATGAAAATGG - Intergenic
1028772936 7:94647779-94647801 ATGAGTAAATATTAGTAAGGAGG - Intronic
1029320392 7:99753626-99753648 ATGAATAGATAAGAGGCACAGGG - Intergenic
1030649277 7:112099784-112099806 ATTTATAAATATGAGGGAGGGGG - Intronic
1030943734 7:115689954-115689976 ATGAATAAATATTTGGAAGGAGG + Intergenic
1031719548 7:125154497-125154519 ACGAATAAAAATGAGACAGATGG + Intergenic
1031791176 7:126106808-126106830 ATAAAAAAAATTGAGGAAGAGGG + Intergenic
1032846393 7:135755257-135755279 ATGAATGAATAGGAGCATGATGG - Intergenic
1033099614 7:138459649-138459671 ATGAATGAGTATGAAGAATAAGG - Intergenic
1033617293 7:143029002-143029024 ATGAAGAAACATGAGCGAGAAGG + Intergenic
1033737765 7:144240752-144240774 ATGAATAATTATGAGTTAAAAGG + Intergenic
1033745290 7:144310205-144310227 ATGAATAATTATGAGTTAAAAGG - Intergenic
1033883896 7:145920699-145920721 ATGAATAAAAATGAGTGAAAAGG - Intergenic
1034857647 7:154567482-154567504 ATGAAAAAACAAGAAGAAGAAGG - Intronic
1035506247 8:136408-136430 GGGAATAAATATGAGCAAAATGG - Intergenic
1035767122 8:2115215-2115237 ATTAATAAAGATGGGGAAAATGG + Intronic
1036108960 8:5876655-5876677 ATGAATTAACACGGGGAAGAGGG - Intergenic
1036524191 8:9519706-9519728 ATGAATGAATATCAGGAACTGGG + Intergenic
1037146080 8:15574320-15574342 ATAAATAAATATGATGAGTATGG + Intronic
1037411127 8:18598818-18598840 AAGAATAAACATGATCAAGAAGG + Intronic
1037628164 8:20626808-20626830 ATAATTAAAAATGAGAAAGATGG + Intergenic
1038883547 8:31639851-31639873 ATAAATAAATAAAAGGAGGAGGG + Intronic
1039098146 8:33909240-33909262 ATTCCTAAAAATGAGGAAGAAGG + Intergenic
1039410877 8:37354099-37354121 ATAAATAAAGGTGAGGAACAAGG - Intergenic
1039816570 8:41099993-41100015 ATAAATAAAAAGAAGGAAGAAGG - Intergenic
1040584248 8:48725451-48725473 ATGAAAGAATGAGAGGAAGAAGG - Intronic
1040717789 8:50279259-50279281 ATCAATAAACATGTGGAAAATGG + Intronic
1040918122 8:52584849-52584871 TTGAATAAATATAAGGAAGTAGG - Intergenic
1041079003 8:54197260-54197282 AGGAATAAATATAACCAAGAAGG - Intergenic
1041079646 8:54204110-54204132 ATATATATATATGAGTAAGATGG - Intergenic
1041219840 8:55639155-55639177 AAGAATAAATATCATGAAAATGG + Intergenic
1041419963 8:57655714-57655736 ATGAATAAGTTTCAGAAAGATGG - Intergenic
1041718521 8:60953941-60953963 AAGGATGAATATGTGGAAGAAGG - Intergenic
1041764263 8:61401600-61401622 AAGAATAAATATTGTGAAGATGG + Intronic
1041902960 8:63002084-63002106 GTGAATAAATATCAGTAAAAAGG - Intergenic
1042398185 8:68315173-68315195 ATGAATAAATATGAGGAAGAAGG - Intronic
1042880972 8:73488526-73488548 GGGAAGAAATATGAGGAAAAGGG + Intronic
1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG + Intergenic
1043093240 8:75930707-75930729 AAGAATCAATATCAGGAAAATGG + Intergenic
1043277882 8:78423149-78423171 AGGAATAAATTTAAGGAAGAAGG - Intergenic
1043522633 8:81063079-81063101 ATGAATAACTATGAGAAACTTGG + Intronic
1044228896 8:89751444-89751466 ATGAAGAAAGAAGAGGAAGGGGG + Intergenic
1044584134 8:93853638-93853660 ATGAATAAAAATAAGTAAGTGGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044972515 8:97633851-97633873 AGGAAAAAAGAAGAGGAAGAAGG - Intergenic
1045667715 8:104507928-104507950 ATGAAAAAAGATGAGAAAGTAGG + Intronic
1045804467 8:106141356-106141378 AAGAATAAACAAGAGCAAGAGGG - Intergenic
1045839763 8:106565520-106565542 AAGAATAAATATCATGAAAATGG + Intronic
1045904988 8:107334039-107334061 ATGGATAAATATGAGAAGGAGGG + Intronic
1046004802 8:108465925-108465947 GAGTATAAATATGAGGAAAATGG + Intronic
1046078673 8:109343369-109343391 ATAAAAAAATAAGAGTAAGAAGG - Intronic
1046387609 8:113524356-113524378 AAGAATAAATATCATGAAAATGG - Intergenic
1046410230 8:113832202-113832224 AAGAATCAATATCATGAAGATGG - Intergenic
1046548800 8:115685854-115685876 ATGATTAATTCTGAGGAAGGAGG + Intronic
1046887266 8:119381203-119381225 AAGAATCAATATTATGAAGATGG + Intergenic
1046924689 8:119773572-119773594 AAGTAAAAATATGAGGAAGATGG + Intronic
1046976205 8:120280874-120280896 AAGAATAAACATAAGGAATATGG - Intronic
1047033476 8:120909969-120909991 ATGAATAAATAAGAGTCTGAAGG - Intergenic
1047073016 8:121368490-121368512 AAGAGCAAATATCAGGAAGATGG - Intergenic
1047089820 8:121561514-121561536 ATGAGTAAATATGAGACAAATGG - Intergenic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1047633372 8:126732400-126732422 ATGAATAAATTTGACCAAGGAGG - Intergenic
1047882915 8:129216178-129216200 ATGAAAAGATAGGAGGAAGATGG - Intergenic
1048015972 8:130498336-130498358 ATAAATAAATAAAAGGAGGAGGG - Intergenic
1048092354 8:131254867-131254889 AAGAATAAATATCATGAAAATGG + Intergenic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1048674512 8:136763230-136763252 AAGAATAAATATCATGAAAATGG - Intergenic
1048739498 8:137538833-137538855 AAAAATAAAGATGAGGGAGATGG + Intergenic
1048813362 8:138308579-138308601 AAGAATAATTATGATGAAGTTGG - Intronic
1048941113 8:139401636-139401658 ATTATTAAATATGAGAAGGAGGG + Intergenic
1049036442 8:140079950-140079972 AATAATAAAAATGAAGAAGAAGG + Intronic
1050369146 9:4902669-4902691 ATGAAGCAATATAATGAAGAGGG - Intergenic
1050976649 9:11947491-11947513 ATGGCCAAATATGAGTAAGATGG + Intergenic
1051241659 9:15063120-15063142 AAGAATCAATATGATGAAAATGG + Intergenic
1051300822 9:15648790-15648812 AAGAATAAATATCATGAAAATGG + Intronic
1051303574 9:15681425-15681447 AAGAAGAAAGAAGAGGAAGATGG - Intronic
1051305618 9:15705873-15705895 ATGAATTAATATCAGGTTGAAGG + Intronic
1051525204 9:18035424-18035446 GTGAGGAGATATGAGGAAGAGGG + Intergenic
1051925499 9:22320044-22320066 ATCAATAAATATGAGGATGCTGG - Intergenic
1052048269 9:23820296-23820318 ATGAAGAATTATTAGGAATAGGG + Intronic
1052426853 9:28315487-28315509 ATAAATAAAGATGAGGCACATGG - Intronic
1052490939 9:29166934-29166956 ATAGATAGATATGAGAAAGAGGG + Intergenic
1053678029 9:40457715-40457737 ATAAAGAAATATAAGGAAGAAGG - Intergenic
1053927947 9:43085745-43085767 ATAAAGAAATATAGGGAAGAAGG - Intergenic
1054285705 9:63167225-63167247 ATAAAGAAATATAAGGAAGAAGG + Intergenic
1054291101 9:63293252-63293274 ATAAAGAAATATAAGGAAGAAGG - Intergenic
1054389118 9:64597787-64597809 ATAAAGAAATATAAGGAAGAAGG - Intergenic
1054506596 9:65918583-65918605 ATAAAGAAATATAAGGAAGAAGG + Intergenic
1054710169 9:68503048-68503070 GTGAATAAATATGAGGGACCTGG - Intronic
1054880212 9:70136634-70136656 ATGAAAAAAAAGGAGGAAGGGGG + Intronic
1054980316 9:71198470-71198492 AAGAATCAATATCATGAAGATGG - Intronic
1054991453 9:71331869-71331891 AGGAAGAAAGAGGAGGAAGAAGG + Intronic
1055692944 9:78853283-78853305 ATTAAAAAATATGAAGAAGAAGG - Intergenic
1056608017 9:88103364-88103386 ATGAGGAAAGAGGAGGAAGATGG - Intergenic
1056651418 9:88467580-88467602 ATGAACAACAAGGAGGAAGATGG + Intronic
1056984764 9:91352439-91352461 ATGAATAAAGTAGAGGAAGTAGG + Intronic
1057364463 9:94406007-94406029 AGGAATAAATGTAACGAAGAAGG - Intronic
1057469550 9:95345292-95345314 ATGAATAAATAAAAACAAGATGG - Intergenic
1058029688 9:100181658-100181680 AAGAATCAATATGATGAAAATGG + Intronic
1058073675 9:100628041-100628063 ATGAATAAATATAAAGAAAATGG - Intergenic
1058267547 9:102923417-102923439 ATCAATGAAGATGAGGATGAAGG + Intergenic
1058340341 9:103887570-103887592 ATAAATAAATATGAGAAAACAGG - Intergenic
1058561449 9:106233207-106233229 AGGAAGAAAGAGGAGGAAGAAGG - Intergenic
1058561462 9:106233272-106233294 AGGAAGAAAGAGGAGGAAGAAGG - Intergenic
1058728278 9:107824435-107824457 ATAAAGGAAGATGAGGAAGAAGG - Intergenic
1059717466 9:116926883-116926905 TTAAATATATATGAGGGAGAGGG + Intronic
1060753767 9:126193987-126194009 CTCAATCACTATGAGGAAGAAGG - Intergenic
1060922599 9:127432709-127432731 AAGAATAAAGATATGGAAGATGG - Intronic
1061569536 9:131468317-131468339 ATGAAGAAATATGGGTGAGAGGG - Intronic
1203602062 Un_KI270748v1:20922-20944 GGGAATAAATATGAGCAAAATGG + Intergenic
1185936823 X:4265894-4265916 ATGAATCAATTTGGGGAAAAGGG - Intergenic
1185953761 X:4465932-4465954 ATGAAGAAAAATGGAGAAGACGG - Intergenic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186047145 X:5548779-5548801 ATGGATGAAGAGGAGGAAGAAGG - Intergenic
1186940522 X:14501921-14501943 ATAAAGACATAGGAGGAAGACGG - Intergenic
1187804039 X:23098584-23098606 ATGAATAAATATAATTAAAATGG + Intergenic
1187945108 X:24418610-24418632 ATGAATAAAAAAGAGAAAAAAGG + Intergenic
1188071168 X:25720062-25720084 ATGAGTAAATATGAGGGACAGGG + Intergenic
1188155117 X:26732213-26732235 ATGAATCAATATCATGAAAATGG - Intergenic
1188343214 X:29030652-29030674 TTGAATAAATATGTTGAACATGG + Intronic
1190287557 X:48971292-48971314 AAGACTAAATAAGAGGAAGGGGG + Exonic
1190751438 X:53365241-53365263 ATAAATAAACATATGGAAGACGG - Intergenic
1190755029 X:53394301-53394323 ATGGGTAAATATGGGGAGGAAGG + Intronic
1190933552 X:54971936-54971958 AAGAATCAATATCATGAAGATGG - Intronic
1190955679 X:55190903-55190925 ATAAATAAATAAGACAAAGATGG - Intronic
1191023403 X:55887294-55887316 ATGAATCAATATCGTGAAGATGG - Intergenic
1191167999 X:57411813-57411835 AAGAGTAAATATGTTGAAGAGGG - Intronic
1191597555 X:62962283-62962305 AAGAATAAATATCATGAAAATGG - Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1191794402 X:65005124-65005146 AAGAATAAATATCATGAAAATGG + Intronic
1191969580 X:66798638-66798660 ATGAAGAAAAATGAGAATGAAGG - Intergenic
1192270220 X:69572160-69572182 AAGAGTAAATAAGAGGTAGAAGG - Intergenic
1192283901 X:69713359-69713381 CTGAAGAAATATGAATAAGATGG - Intronic
1192406917 X:70895415-70895437 AAGAATAAATATCATGAAAATGG + Intronic
1192612586 X:72582280-72582302 AAAAAGAAGTATGAGGAAGAGGG + Intronic
1192675258 X:73189141-73189163 AAGAATCAATATGATGAAAATGG + Intergenic
1193039135 X:76986458-76986480 TTGAAAAAATATAAGGAAGGGGG - Intergenic
1193267271 X:79486643-79486665 AAGAATAAATATCATGAAAATGG + Intergenic
1193365922 X:80633093-80633115 ATGATTAAATATGACCAAGTGGG - Intergenic
1193468403 X:81872988-81873010 ATGATGAAATAGGAGAAAGAAGG - Intergenic
1193502402 X:82295455-82295477 ATGCATACATATGTTGAAGAGGG - Intergenic
1193623579 X:83788606-83788628 AAGAATAAATATGGTGAAAATGG + Intergenic
1193734095 X:85136066-85136088 ATTAATACATGTGAGGATGAGGG + Intergenic
1193746986 X:85293983-85294005 ATAAATAAAGAAGAAGAAGAAGG + Intronic
1193747993 X:85306701-85306723 AGGAGTAAAGATCAGGAAGAGGG + Intronic
1194635077 X:96335694-96335716 AGGAATGGATATGAGCAAGAAGG - Intergenic
1194710608 X:97232226-97232248 ATAAATAAATAAGATGAGGAAGG - Intronic
1194911775 X:99654020-99654042 ATTTCTACATATGAGGAAGATGG + Intergenic
1195390620 X:104358364-104358386 CTGAAAAATTATGAGGATGAGGG + Intergenic
1196361976 X:114872155-114872177 GTGAATAAATGGGAGGAGGAAGG - Intronic
1196884869 X:120234774-120234796 ATGAGGAAAAATGGGGAAGAAGG - Intergenic
1197324602 X:125076779-125076801 GTTAACAAAAATGAGGAAGATGG - Intergenic
1197832491 X:130659227-130659249 ATGAATAAAAAGGAGGATGTTGG - Intronic
1198656496 X:138919367-138919389 GTAAATTAATAAGAGGAAGATGG + Intronic
1198721835 X:139630656-139630678 AAGAACAAGTATGAGGAAAATGG + Intronic
1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG + Intergenic
1199277063 X:145957688-145957710 CTGAAAAAATATGAGCAAAAGGG + Intergenic
1199319811 X:146425084-146425106 ATGTAGGAATGTGAGGAAGAAGG + Intergenic
1200538029 Y:4423166-4423188 AAGAATAAATATCATGAAAATGG + Intergenic
1201246486 Y:12008979-12009001 AAGAATCAATATCAGGAAAATGG - Intergenic
1201481157 Y:14440953-14440975 ATGTTTAAATATGGGGAAGCGGG - Intergenic
1201498417 Y:14615036-14615058 AAGAATAAATATCATGAAAATGG - Intronic
1201958807 Y:19655722-19655744 ATGAATCAATATTATTAAGATGG - Intergenic
1201971815 Y:19805988-19806010 AAGAATCAATATCAGGAAAATGG + Intergenic
1202055203 Y:20822605-20822627 AAGAATCAATATCAGGAAAATGG - Intergenic