ID: 1042400379

View in Genome Browser
Species Human (GRCh38)
Location 8:68338464-68338486
Sequence CTGAAGATGCAGAAGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 346}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042400379_1042400384 14 Left 1042400379 8:68338464-68338486 CCTTACTCCTTCTGCATCTTCAG 0: 1
1: 0
2: 3
3: 32
4: 346
Right 1042400384 8:68338501-68338523 CCTTTTTGTCACTATGGATTAGG No data
1042400379_1042400382 8 Left 1042400379 8:68338464-68338486 CCTTACTCCTTCTGCATCTTCAG 0: 1
1: 0
2: 3
3: 32
4: 346
Right 1042400382 8:68338495-68338517 TGATCTCCTTTTTGTCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042400379 Original CRISPR CTGAAGATGCAGAAGGAGTA AGG (reversed) Intronic
902618500 1:17636978-17637000 GTGATGATACAGATGGAGTAAGG - Intronic
903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG + Intronic
903230678 1:21920606-21920628 CTGAGGTTGCAGAGAGAGTACGG - Intronic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
904383640 1:30127737-30127759 CTAAAGAATCAGAAGGAGCATGG - Intergenic
904633827 1:31864213-31864235 GTCAAGAGGCAGAAGGAGCAGGG + Intergenic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
906418046 1:45637960-45637982 CGTAAGATGAAGAAGGTGTAAGG + Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907750593 1:57259354-57259376 CAGAAGATGCTAAAAGAGTAGGG + Intronic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909288121 1:73847115-73847137 GGGAAGAGGAAGAAGGAGTAGGG - Intergenic
911439282 1:97905243-97905265 CTAAAGATGCAAAGGGAGCAAGG + Intronic
911458857 1:98162977-98162999 CTCCAGGTGCAGAGGGAGTAAGG + Intergenic
912260823 1:108110503-108110525 GTGAAGATGGAGCAGGAGCAAGG + Intergenic
915608568 1:156971707-156971729 CTGAAGATCCAGCAGGAGACTGG - Exonic
915610243 1:156986168-156986190 CTTAACCTGGAGAAGGAGTAAGG + Exonic
916819185 1:168381564-168381586 CTGAAGTTGAAGAAGGATGAAGG + Intergenic
917422897 1:174883408-174883430 CTGGAGACGCAGGAGGAGTTGGG + Intronic
918114125 1:181482656-181482678 GAGAAGATGCGGAAGGAGAATGG - Intronic
918401243 1:184164674-184164696 GTGAGCATGCAGAGGGAGTAGGG + Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
921452508 1:215324939-215324961 CAGAAGGTGAAGGAGGAGTAAGG + Intergenic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
921636430 1:217500278-217500300 CTGAAGAGGAGGGAGGAGTAAGG - Intronic
924579419 1:245311061-245311083 ATGAAGCTGAAGAAGGAGAAAGG + Intronic
1063040211 10:2330028-2330050 TTGAAGGTCCAGAAGGAGAAGGG + Intergenic
1065932541 10:30492416-30492438 CAAAAGATGCAGACGGAGTCTGG + Intergenic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1067796374 10:49325065-49325087 CAGAAGATGGTGAGGGAGTAAGG - Exonic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1075173129 10:120134373-120134395 CTGAACATGCAGCAGGGGCATGG + Intergenic
1076146741 10:128127777-128127799 CTGCAAATGCAGAAGCAGTGAGG + Intergenic
1076265605 10:129107624-129107646 ATGAAGATGCAGATGGGGAAGGG + Intergenic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1076912948 10:133401463-133401485 CAGAAGCTGCAGAACAAGTAGGG - Intronic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077177485 11:1197330-1197352 CTGAGGACCCAGCAGGAGTAGGG - Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080117655 11:28638844-28638866 CCGAAGAAGCACAAGGAGTGGGG + Intergenic
1080394313 11:31875902-31875924 AGGAAGCTGCAGAAGGAGGAGGG - Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1084045305 11:66564649-66564671 CTGGAGGTGGAGAAGGAGTAGGG + Intronic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1085024791 11:73230127-73230149 CAGAAGCTGCAGGAGGAGCAAGG - Intronic
1085184008 11:74559954-74559976 CTGAGGATCCAGAAGGACTTAGG + Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1087424517 11:97970515-97970537 CTGAAGGTGCAGTTGGAGGAAGG + Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092188772 12:6502087-6502109 CTGATGCTGCAGAAGGAAGAGGG + Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1092955068 12:13542256-13542278 TTAAAGATGAACAAGGAGTAAGG + Exonic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1093914596 12:24787571-24787593 CTGCAGATGCTAAGGGAGTAGGG + Intergenic
1095594120 12:43939579-43939601 CTGAAGTGGCAGTAGGAGAAGGG - Intronic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1099113389 12:78591673-78591695 CTAATGAAGCAGAATGAGTAGGG + Intergenic
1099245358 12:80187390-80187412 CTGAAGATCCAGCAGAAATATGG + Intergenic
1100272128 12:93036282-93036304 CTGAAGATGCAAAAAAGGTAAGG + Intergenic
1100370157 12:93961772-93961794 TTAAAGATTCAGAAGGAGAAGGG + Intergenic
1100465917 12:94845202-94845224 CTGAAGACGGAGAAGGGATACGG - Intergenic
1100478175 12:94953096-94953118 CAGGACATGCAGCAGGAGTATGG - Intronic
1102697715 12:114813250-114813272 CTGAGGAAGCAGAGGAAGTAGGG - Intergenic
1102730167 12:115102161-115102183 GTGAAGATGGAGAAGGACGAGGG + Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1104082709 12:125444983-125445005 CTGGAGATGTAGAACTAGTAGGG - Intronic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104999883 12:132683361-132683383 CTGAAGATGAAGAAGCAGCAAGG + Intronic
1105923371 13:24985071-24985093 CAGAAGATACAGCAGGAGAAGGG + Intergenic
1106170499 13:27284246-27284268 CTGGAGATGTAAAAGGAGTTGGG + Intergenic
1107160578 13:37222597-37222619 TTGAAGATGCAGAAAAAGAATGG - Intergenic
1107453797 13:40536165-40536187 CTGAATATGCAGAGGGCTTAAGG + Intergenic
1108102533 13:46972177-46972199 CTGAAGAAGCATAATGTGTAAGG - Intergenic
1110483290 13:76008523-76008545 CTAAAGATACAAAAGGAGTAAGG - Intergenic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1111716767 13:91888140-91888162 CAGAAGATGTAGGAGGAGCAAGG + Intronic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1113401100 13:109994131-109994153 CTGAAGATGATGAAGGAGCCAGG + Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1114138193 14:19877848-19877870 CTGATAATGCGGAATGAGTAGGG + Intergenic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1118342527 14:64906855-64906877 CGGGAGATGGAGAAGGAGAAAGG - Intergenic
1118839649 14:69500919-69500941 CTGGAGATGCTGCAGGAGTCTGG + Exonic
1120663859 14:87282513-87282535 CTGAAGAGGCAGATGGTTTAGGG + Intergenic
1121216616 14:92253460-92253482 GTGGAGATGCACAAGGAGTCAGG + Intergenic
1121430144 14:93880755-93880777 CTGAGGATGCAGAAGGGCCAGGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123674063 15:22690641-22690663 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1124326071 15:28763633-28763655 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1127540273 15:59930837-59930859 GTGAAGATGGAGAAGGTGCAGGG - Intergenic
1127664654 15:61133834-61133856 CTGATGATGCAGTAGGAAGAAGG - Intronic
1128053858 15:64685370-64685392 CTGAGGATGCATATGGAGCAGGG - Exonic
1129085717 15:73088906-73088928 AAGAAGATTCAGAAAGAGTAAGG + Intronic
1129707091 15:77800473-77800495 CCGAAGATGGAGATGGAGCATGG + Intronic
1130614337 15:85390376-85390398 ATGAAGATTCAGAGGAAGTATGG + Intronic
1131325130 15:91435959-91435981 CTGAAGTAGCATAAGGAGCATGG - Intergenic
1131940485 15:97559601-97559623 CAGAAGATGTAGAAGTGGTATGG - Intergenic
1132170676 15:99650853-99650875 CTGCAGATTCAGAAGGTCTAAGG - Intronic
1133392224 16:5419824-5419846 TTGAAGATGGAGAAGGAGTGTGG + Intergenic
1133888432 16:9854265-9854287 CTGAAGTTGCAGTAAGAGCAAGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135089236 16:19499757-19499779 CTGAAGAAGCACAGGGACTAAGG + Intergenic
1136360818 16:29778581-29778603 GAGAAGTTGCAGAAGGAGTCGGG - Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137751135 16:50861874-50861896 GTGATGATGCAGAAGGAGTGGGG - Intergenic
1138231523 16:55340516-55340538 CACATGAGGCAGAAGGAGTAGGG + Intergenic
1139179744 16:64732467-64732489 ATGAAGATGGAGAAGGTGAAGGG - Intergenic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139642342 16:68301309-68301331 CTGGATGTGCAGAAGGAGTTCGG - Exonic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1142257454 16:89021329-89021351 CTGAAGACGCAAAAAGAATAAGG + Intergenic
1143019953 17:3912202-3912224 ATGAAGACACAGGAGGAGTAAGG - Intronic
1143907856 17:10223884-10223906 CTGAAGATGTGGGAGGAGTGGGG + Intergenic
1144615810 17:16770788-16770810 CAGAGGATGCTGAAGGATTAAGG - Intronic
1144896893 17:18544883-18544905 CAGAGGATGCTGAAGGATTAAGG + Intergenic
1145135320 17:20399331-20399353 CAGAGGATGCTGAAGGATTAAGG - Intergenic
1146380410 17:32323378-32323400 GGGAGGATGCAGAAGGAGTCAGG + Exonic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146684401 17:34831249-34831271 CAGAAGATCCAGAAAGAGAATGG + Intergenic
1146807031 17:35872816-35872838 CTTAAGATGCAGAGAGAATAAGG + Intronic
1148616861 17:49007279-49007301 CTACAGAAGCAGAAGAAGTAGGG - Intronic
1149804341 17:59600932-59600954 CTGGAGATGGAGAAGTGGTAAGG - Intronic
1151052601 17:70995603-70995625 GTCAGGAGGCAGAAGGAGTAGGG - Intergenic
1151394616 17:73814267-73814289 CTGAAGATGCAGCAGGTTTCCGG - Intergenic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152783745 17:82237644-82237666 CTGAAGAGGTAGACGGAGTAGGG - Exonic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1157476279 18:48025512-48025534 GTGAAGATGGAGAAGGGGAAGGG - Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157866184 18:51187079-51187101 CTTAATATGCAGAAGGGGTGGGG - Intronic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1161921301 19:7268201-7268223 CGGCAGGTGCAGAAGGAGAAAGG + Intronic
1163860255 19:19739054-19739076 CTGGGGATGCAGACAGAGTAGGG - Intergenic
1164082628 19:21873698-21873720 GTAAAGATGCAGAAGGTGAAAGG - Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167699326 19:51033303-51033325 CTGAAGTTGCACAAAGAGTTTGG + Intronic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926769960 2:16362161-16362183 CTGAAGATAGAGAATGAATAAGG - Intergenic
927114877 2:19889874-19889896 AAGAAGATGCAGGTGGAGTAGGG - Intergenic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
927951757 2:27175023-27175045 CTGAGGATGCAGAAGGCAGAGGG - Intergenic
928822470 2:35378090-35378112 CAATAAATGCAGAAGGAGTAAGG - Intergenic
929421191 2:41791555-41791577 CTGAAAATGAAAAAGGAGAATGG + Intergenic
931039543 2:58282203-58282225 CTAAAGATGCACATGGAGTCAGG - Intergenic
932381943 2:71292195-71292217 AGGAAGATGCTGAAGGAGTTTGG - Intronic
932498847 2:72162434-72162456 CTGTAGATGGAGAAGCAGTTAGG - Intergenic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
935126908 2:100232325-100232347 CAGAAGATGATTAAGGAGTAAGG - Intergenic
938034641 2:128026868-128026890 GGGAAGATGGAGAAGGTGTAGGG - Intronic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
940859585 2:158758106-158758128 CTGAGGATCCAGAACGAGTGTGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942677143 2:178439332-178439354 CTGAAGGTGGAGAAGGGGCAAGG - Intronic
942856611 2:180556167-180556189 CTCTAGATGCAGAAGGGATAGGG + Intergenic
943726368 2:191255777-191255799 CTCAAAATGCAGAGGGGGTAGGG - Intronic
944444314 2:199774305-199774327 CTGAAGATGCTGAATTTGTAGGG - Intronic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
944839144 2:203608657-203608679 GTCAAGGTGCAGAGGGAGTATGG - Intergenic
945178332 2:207066067-207066089 AAGAAGATGCAGCAGAAGTATGG + Intergenic
945927332 2:215819202-215819224 CTCAAGAAGCACAAGGAGTTGGG + Intergenic
946026389 2:216674202-216674224 CTCAAGATGCAAAGGGAGAATGG + Exonic
946145295 2:217725974-217725996 CTGACGATGCAGTAGGTTTAAGG - Intronic
947233857 2:227919910-227919932 CTGTAGGTGCAGAAGCAGAAAGG - Intronic
948085497 2:235243388-235243410 TTGAACAGGCAGAAGGACTAAGG + Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
1169285904 20:4306934-4306956 CTGAAGATGAAGACGATGTAAGG + Intergenic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1169524857 20:6413296-6413318 CTGAGGATGCAGAAAAAGAAAGG + Intergenic
1170294164 20:14806334-14806356 CTGAAGAAGCACAAGGGGTTGGG + Intronic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171790541 20:29519102-29519124 TTGAAGATGCTGAAGAAGCAAGG - Intergenic
1171857168 20:30357733-30357755 TTGAAGATGCTGAAGAAGCAAGG + Intergenic
1172232854 20:33348608-33348630 CTGAGGAGCCAGAAGGAGCAGGG + Intergenic
1173997925 20:47353698-47353720 CTGAGGAGGCAGAAGGAAAAAGG + Intronic
1174029593 20:47611820-47611842 CTGGAGGGGCAGAAGGAGTGGGG - Intronic
1174365783 20:50055367-50055389 CTGAAGCTGCAGGAGCAGTCCGG + Intergenic
1177252357 21:18611151-18611173 CTGAAGATGGAGAATGAGCTAGG + Intergenic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1183523602 22:38310732-38310754 CTTATGATGCAGAGGGAGAAGGG + Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184791899 22:46705232-46705254 TGGAAGATGCAGAGAGAGTATGG + Intronic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949582725 3:5406857-5406879 CTGAAGATGGAGGAGAAGCAAGG - Intergenic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
951857193 3:27210596-27210618 CAGAAGTCGCAGAAGGAATAGGG - Intronic
951899649 3:27644412-27644434 CTGACTATGCAGAACAAGTATGG + Intergenic
952212183 3:31239203-31239225 CTCAAGGTGGAGAAGGAATATGG - Intergenic
953929400 3:46998504-46998526 CAGAAGCTGCGGAAGAAGTACGG + Exonic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954156291 3:48686466-48686488 CTGAAGAGAGAGGAGGAGTAGGG - Intergenic
954701645 3:52453811-52453833 TTGAGGATGCAGAAGGGGTAGGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955714365 3:61813162-61813184 CTGAGGCTGTAGAAAGAGTAAGG + Intronic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
959681198 3:109098500-109098522 CTGGAGATGCATATGGAGTTTGG - Intronic
960295369 3:115936447-115936469 CTGAAAATGCAGACAGAGTGAGG + Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
961514805 3:127425844-127425866 CTCAAGATGCAGAAGGGGCCGGG + Intergenic
962273797 3:133997233-133997255 TTGCAGAGGCAGAGGGAGTAGGG - Intronic
963327355 3:143877153-143877175 CTCAAGATGGAGGAGGAGGAGGG - Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964333516 3:155629910-155629932 CTGAATATAAAAAAGGAGTAAGG - Intronic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965972309 3:174575348-174575370 CTGAAGATGCTGAATAACTAAGG - Intronic
966979802 3:185121665-185121687 GTGAAGTTGGAGAAGTAGTAAGG + Intronic
970216867 4:13767832-13767854 ATGAAGATGCTGAGAGAGTAAGG - Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971807407 4:31377344-31377366 CTGTAGATCCAGAAGGCTTAGGG - Intergenic
972267483 4:37476416-37476438 ATGAAGATGCTGAAGGGATATGG - Intronic
972326557 4:38021958-38021980 CTGAGGATGGAGGAGGAGTTAGG + Intronic
972551334 4:40137717-40137739 GTCAGGAGGCAGAAGGAGTAGGG + Intronic
975363899 4:73505449-73505471 CTGAAGGTGCAGAGTGAGAAAGG + Intergenic
975979637 4:80142892-80142914 CTTAAAATGTAGAAAGAGTAGGG - Intergenic
976005075 4:80420030-80420052 TTGAGGTTGCAGAAAGAGTAGGG + Intronic
976343179 4:83967307-83967329 CTGATGAAGCAGCAGGAGAAGGG - Intergenic
976639591 4:87323949-87323971 CTCAAGTGGCAGAAGGAGGAAGG + Intergenic
977433360 4:96960899-96960921 CTGAGGATGGGGAAGGAATATGG - Intergenic
982497572 4:156110029-156110051 GTGAGGAGGCAGAAGGAGTTGGG + Intergenic
984982325 4:185294446-185294468 ATGAAGATACTGAAGGAGTCAGG + Intronic
985034037 4:185820535-185820557 CTGCAGTTGGGGAAGGAGTAGGG + Intronic
985434177 4:189913094-189913116 CTGAAGATGCTGGAGAAGCAAGG + Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
988857059 5:35237821-35237843 CTGAAGATCAAGAATGGGTAAGG - Intergenic
990674953 5:58173490-58173512 TTGAAGATCAAGAAAGAGTAAGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992601620 5:78406697-78406719 CTGAAGAGGCAAATGTAGTAAGG + Intronic
995739706 5:115342854-115342876 GTGGATATGCAGAAGGAGTGGGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996809777 5:127503795-127503817 CTGTAGTTGGAGAAGAAGTAGGG + Intergenic
997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG + Intergenic
997807611 5:136934575-136934597 CTCAGGTTGCAGAAGGAGTAGGG + Intergenic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
999991006 5:157049784-157049806 ATGCAGATGCAGAAGGAGCTGGG - Intronic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001168953 5:169398844-169398866 CTGAAGACCCAGAAGAAATAGGG + Intergenic
1001241667 5:170076049-170076071 ATGAAGGTGGAGAAGGAGTACGG + Exonic
1001283404 5:170404615-170404637 GACAAGATGCAGAAGCAGTAGGG + Intronic
1001977309 5:176010428-176010450 CAGGACATGCAGCAGGAGTATGG - Intronic
1002240117 5:177833352-177833374 CAGGACATGCAGCAGGAGTATGG + Intergenic
1002539163 5:179894517-179894539 CTGAAGATGCGGAAGCAGTTTGG - Exonic
1002553395 5:180015435-180015457 CTCAAGCTGGAAAAGGAGTAGGG + Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1004233243 6:13851487-13851509 CTGAGGAGGCAGAAGGACAAAGG - Intergenic
1004698418 6:18055864-18055886 GTGAAGATGCTGAATGAATATGG - Intergenic
1006258639 6:32850821-32850843 ATGAAGATGGAGAATCAGTAAGG + Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007977031 6:46112455-46112477 TTGAAGATGCAGAAAGAATGGGG - Intergenic
1008826699 6:55703138-55703160 CTGCAGATAGAGAAGGACTAGGG - Intergenic
1010130716 6:72490342-72490364 CTGAGAATGAAGAAGGTGTAAGG + Intergenic
1010787593 6:80022406-80022428 TTGAAGATGCAGCAGGATTCTGG - Exonic
1012333429 6:98023075-98023097 AAGGAGATGCAGAAGGAATATGG - Intergenic
1013751133 6:113407733-113407755 CGGAAAAGTCAGAAGGAGTAAGG - Intergenic
1013853694 6:114545669-114545691 CTGAAGATAGAGAAGGAATCAGG + Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015359825 6:132327090-132327112 CTGGAGATGCTGAAGGGTTAGGG - Intronic
1015450968 6:133365584-133365606 GTCAGGATGCAGAAGGAGGAAGG + Intronic
1016562971 6:145417894-145417916 CTGAAGGAGCTGAAGGAGTGTGG - Intergenic
1016887596 6:148972316-148972338 AAGAAGATGCAGCAGAAGTAAGG + Intronic
1018219726 6:161565987-161566009 CTGATGATGCAGAAGGGGGAAGG - Intronic
1018909198 6:168092253-168092275 CTGGAGATGCACAAGGACTGTGG - Intergenic
1019049293 6:169170755-169170777 CTGAAGATGCATGAGGATGAGGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019742211 7:2680549-2680571 CTGGAGATGCCCAAGGAGTAGGG + Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1021345601 7:19524448-19524470 CTGAAAATGAAGAAGCAGAAAGG + Intergenic
1022578165 7:31518904-31518926 CAGAAGATGCAAAAGAAGTTGGG + Intronic
1022802867 7:33792530-33792552 CTGATGTTGCAGCAGGAGTGGGG - Intergenic
1024118322 7:46213353-46213375 CTCAGGAAGCAGAAGGAGCAGGG + Intergenic
1024264874 7:47598796-47598818 CTGAAGCTGTAGAAGGAGGCAGG - Intergenic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1024991784 7:55240435-55240457 AAGAAGAGGCAGAAGGAGAAAGG - Intronic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026777142 7:73237602-73237624 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027017988 7:74790974-74790996 CTGAACAAGCAGAAGGGGTGAGG - Intergenic
1027070036 7:75154953-75154975 CTGAACAAGCAGAAGGGGTGAGG + Intergenic
1027299620 7:76817456-76817478 ATGAAAATACAGAATGAGTAAGG + Intergenic
1027342478 7:77223897-77223919 CTGAAAATACAGCAGCAGTAGGG + Intronic
1027831915 7:83187653-83187675 ATGAAGCTGGAGAAGGAATAAGG + Intergenic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1029540124 7:101177926-101177948 CTGGAGCTGCAGATGGAGTCAGG - Intronic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1031153795 7:118085523-118085545 TTGAAAATGGAGGAGGAGTAGGG - Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031334282 7:120507708-120507730 CTGAAAATTCAGGAGGTGTAGGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032759242 7:134923445-134923467 CAGATGATTCAGAAGGAGTGTGG - Intronic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1035365364 7:158345855-158345877 CTGAGGCGGCAGAAGGAGTGGGG + Intronic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1040985386 8:53288403-53288425 AGGAATATGCAGAAGGAGAAAGG - Intergenic
1041472547 8:58226383-58226405 CAGAAAAGGCAGAAGGAATAGGG - Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1043380293 8:79695290-79695312 ATGAAGAGGCAGAAGGACTCAGG + Intergenic
1044009122 8:86970259-86970281 GTGAAATTCCAGAAGGAGTAGGG - Intronic
1044989598 8:97783786-97783808 CTGAAGTTACAGAAAGAATAGGG - Intronic
1045629695 8:104104013-104104035 CTGAAGATGGAGGAGGAGATGGG + Intronic
1045835073 8:106510533-106510555 CTGAAGAGGCAGAATTAGTTTGG + Intronic
1046249545 8:111612006-111612028 CTGCAGAGGCACAAGGTGTAGGG + Intergenic
1046675725 8:117105871-117105893 CTGGAAATGCAGAAGAAATAGGG - Intronic
1048045186 8:130766397-130766419 GTGAGGATGCAGGAGGAGTCAGG + Intergenic
1048663700 8:136636030-136636052 CTGAAGACCCAAAAGGGGTAAGG - Intergenic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049654779 8:143792707-143792729 CGGAAGATGCAGGAGGAGGAAGG - Exonic
1050576424 9:7000858-7000880 CTGAAGATGTAGAATCAGCATGG + Intronic
1051881199 9:21841259-21841281 CACCAGCTGCAGAAGGAGTAGGG - Intronic
1052566714 9:30162356-30162378 CTCAAGATGCAGAAGAAATATGG + Intergenic
1053412143 9:37922812-37922834 CTGTGGATGCAGCAGGAGAAGGG - Intronic
1053723266 9:40971253-40971275 CTGAAGATGCTGGAGAAGCAAGG + Intergenic
1053858828 9:42364875-42364897 CTTAAGAAGCAGACGCAGTATGG - Intergenic
1054342698 9:63880739-63880761 CTGAAGATGCTGGAGAAGCAAGG - Intergenic
1054814015 9:69457187-69457209 ACCCAGATGCAGAAGGAGTAAGG + Intronic
1055518138 9:77053765-77053787 ATGGAGATGGAGAGGGAGTAGGG - Intergenic
1055693122 9:78855671-78855693 CTGAAGAACCAGAAGTAGCAAGG + Intergenic
1056621187 9:88216419-88216441 CTCATGATGCTGAAGGAGTGAGG + Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059842052 9:118228616-118228638 CTGAAGAGGGAGAAGAAGTTTGG + Intergenic
1060266319 9:122113514-122113536 CTGTCCATGCTGAAGGAGTAGGG + Intergenic
1060320815 9:122559198-122559220 CTGAAGATTTAGGAGGAGTGGGG - Intergenic
1060986859 9:127825071-127825093 CAGAAGACGCAGCAGGAGTGGGG - Intronic
1186662745 X:11685618-11685640 GTGAAGATGCAAAAGAAGTAAGG - Intergenic
1187485757 X:19701576-19701598 CTGAAGATGCAGATGGTGAGTGG - Intronic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189919039 X:45885417-45885439 CATGAGATGAAGAAGGAGTATGG + Intergenic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1190256276 X:48765102-48765124 CTGAAGCTGCAGAATGGGAAAGG + Intronic
1190420986 X:50284204-50284226 ACGAAGATGGTGAAGGAGTAGGG - Intronic
1190449577 X:50565118-50565140 AGGAAGAGGCATAAGGAGTATGG - Intergenic
1191885639 X:65885042-65885064 CTGAGGATGCAGCAGGAAGATGG + Intergenic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1194725887 X:97396668-97396690 CTGAATGTGCAAAAGGATTATGG + Intronic
1195703438 X:107721871-107721893 CTGAAGAGGCTGGAGGAATAAGG + Intronic
1195802796 X:108732817-108732839 CTGCTGATGCCGAAGCAGTAAGG - Exonic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1198440626 X:136659798-136659820 GTGAAGATGCAGAAGGGAAATGG + Exonic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199513947 X:148654831-148654853 CTCAAGCTGAAGAAGGAATAAGG + Intronic
1199539342 X:148941672-148941694 CTGAAGCTGAAGAAGGAGTTGGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic