ID: 1042401505

View in Genome Browser
Species Human (GRCh38)
Location 8:68353953-68353975
Sequence CCTCAGATGCAGAAGGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 266}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042401505 Original CRISPR CCTCAGATGCAGAAGGGGAT TGG (reversed) Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
902222825 1:14977688-14977710 CTTCAGGTGCAGAATGGGCTGGG + Intronic
902225841 1:14996060-14996082 CTCCAGAGGCAGAAGGGGCTGGG - Intronic
903236760 1:21955632-21955654 CTTCAGAGCCAGAAGGGGCTGGG + Intergenic
903620815 1:24696653-24696675 CCTCAGGGGCAGATGGGGACTGG + Intergenic
903648826 1:24910883-24910905 ACTCAGATGCCCATGGGGATGGG + Intronic
903913236 1:26744178-26744200 ACTAAGATGGAGAAGCGGATTGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906677510 1:47703660-47703682 CCTGGGATGCAGAAGGGCCTGGG - Intergenic
907032181 1:51183389-51183411 CCTCAAATACAGAGAGGGATCGG + Intergenic
907826473 1:58021896-58021918 GTTCAGAAGCAGAAGGGGGTTGG + Intronic
911300825 1:96171559-96171581 ACTCAAATGGAGAAGGGGGTAGG - Intergenic
911451669 1:98069660-98069682 CCTCTGATGCTGCAGGGGAGTGG + Intergenic
911842157 1:102696675-102696697 ACTCAGAAGCAAAAGTGGATGGG + Intergenic
911879871 1:103223755-103223777 CTTGAGAGGCAGACGGGGATGGG + Intergenic
912774611 1:112497527-112497549 CCTCAGAAGCAGAATGTTATTGG - Intronic
915047749 1:153032666-153032688 ACTCATACGCAGAATGGGATAGG - Exonic
915512680 1:156394981-156395003 CCCCAGCTGCAGTAGGGGAGTGG + Intergenic
915726638 1:158022787-158022809 CCACAGATGCAGATGTGGAGAGG - Intronic
915906478 1:159881794-159881816 TCTCAGGTGCAGAGGGGCATCGG + Intronic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
917867240 1:179208582-179208604 CCTCAGATGTAGCAGAGAATTGG + Intronic
918943342 1:191028664-191028686 CCTAAAATGCAGAAGAGAATGGG + Intergenic
918973933 1:191456168-191456190 GCTGAGACGTAGAAGGGGATAGG + Intergenic
921411861 1:214844663-214844685 CCTCAGATCTGGAAGGGGAATGG - Intergenic
924459550 1:244246512-244246534 CCTCAGATGACGAATGGGCTGGG - Intergenic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1064822130 10:19349075-19349097 CCTCAGATGCCTAAGGAGCTGGG + Intronic
1065252650 10:23832294-23832316 CCTCAGATGAAGAGGTGCATAGG + Intronic
1065845347 10:29738481-29738503 CATGAGATGGAGTAGGGGATAGG - Intergenic
1066658780 10:37720096-37720118 TCTGAGATGCAGAGGGGGCTGGG - Intergenic
1067087813 10:43252133-43252155 CCCCAGAAGCAGAGGGGGCTTGG + Intronic
1067764048 10:49071815-49071837 CCACACATGCAGGAGGGGTTGGG + Intronic
1067961662 10:50859753-50859775 CCTAAGATGCAAAATGGGAATGG - Intronic
1068104707 10:52599878-52599900 GCTCCAATGCGGAAGGGGATTGG - Intergenic
1068581103 10:58740800-58740822 CGCCAGATGGAGAAAGGGATGGG + Intronic
1068714738 10:60175754-60175776 CCTCAGAGGCAGACTGGGTTTGG + Intronic
1069281699 10:66662646-66662668 CCTAAGAGGCAAAAGGAGATGGG - Intronic
1070422416 10:76250174-76250196 CTTCAGCTGGAGAAGGGGAGAGG + Intronic
1071769937 10:88717055-88717077 CCAGAGATGAAGAAGCGGATGGG + Intergenic
1072991915 10:100204013-100204035 CCTCACATGCAGAAGGGATGAGG + Intronic
1073077786 10:100835575-100835597 ACTCAGATGGGGAAGGGGATGGG + Intergenic
1073779888 10:106825612-106825634 GCTGGGATGCAGAAGGTGATGGG - Intronic
1074532094 10:114305093-114305115 ACGCAGATGCAGGAGGGGACCGG + Intronic
1074532105 10:114305129-114305151 ACGCAGATGCAGGAGGGGACTGG + Intronic
1074532201 10:114305471-114305493 ACGCAGATGCAGGAGGGGACGGG + Intronic
1075817406 10:125275453-125275475 CATCAGGTGCAGCAGAGGATCGG + Intergenic
1076543956 10:131231560-131231582 CCTCTGATGCCGGAGGGGCTCGG - Intronic
1076626687 10:131825126-131825148 CCTCAGGAGCAGAGGGGGAGGGG + Intergenic
1076746753 10:132518349-132518371 CCTCAGATGGGGATGGGGAGTGG - Intergenic
1078455271 11:11470050-11470072 CCTGAGAGGCAGAAGCAGATTGG - Intronic
1078775068 11:14386234-14386256 CCTCACATGTGGAAGGGGAGAGG - Intergenic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1080418020 11:32087822-32087844 CCTCAGAAACAGTAGGGGAAAGG - Intronic
1080422269 11:32121102-32121124 CCTCAGTTTCAGCAGCGGATTGG - Intergenic
1080470592 11:32541756-32541778 CATCAGATTCAGAAAGGGTTGGG - Intergenic
1084442460 11:69182557-69182579 CATCAGATTCAAAAGGGGACTGG - Intergenic
1084913707 11:72411828-72411850 CCTCAGCTGCAGCTGGGGAGGGG + Intronic
1085413646 11:76306385-76306407 CATCAGATGCAGGAGGGGCCCGG + Intergenic
1085637631 11:78170647-78170669 CCACAGCTGCACAAGGGGAAGGG - Intergenic
1089612957 11:119679820-119679842 CCACAGGTGGAGAAGGGGAAGGG - Intronic
1091320645 11:134646900-134646922 CTCCAGGTGCAGAAGGGGAGGGG + Intergenic
1091617285 12:2059219-2059241 GCTGAGATGCAGAAGGTGAGGGG + Intronic
1095126917 12:38490335-38490357 CCTCAGATACTGATGGGGAGGGG + Intergenic
1097436006 12:59552268-59552290 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1097504001 12:60441241-60441263 CCTTACATGCTGGAGGGGATTGG + Intergenic
1099180581 12:79470055-79470077 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1099180813 12:79471448-79471470 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1101972855 12:109328597-109328619 CATGAAATGCAGAAGGGGAAAGG - Intergenic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1104793773 12:131501562-131501584 CCTCAGAATCTGCAGGGGATTGG - Intergenic
1105979979 13:25509088-25509110 CCTCAGATGCAGAGGTGGCCAGG - Intronic
1112467128 13:99654192-99654214 ACTCAGATGCAGGAGAGGCTGGG + Intronic
1112595829 13:100806072-100806094 CCTCAGAGACACAAGGGGAGAGG - Intergenic
1114437046 14:22715006-22715028 TCTAATATGCAGAAGGGGAGAGG + Intergenic
1117572126 14:57058020-57058042 ACTCAGATGCAGTTGGGGGTTGG - Intergenic
1119459214 14:74784940-74784962 CTTCAGATGCAGAGGAGCATGGG + Intronic
1122232417 14:100313346-100313368 CCTCAGAGGCTGAAGGGCTTGGG + Intergenic
1124964401 15:34422632-34422654 CCCCAGAGTCAGAAGGGGGTTGG + Intronic
1124981020 15:34568860-34568882 CCCCAGAGTCAGAAGGGGGTTGG + Intronic
1127256309 15:57296664-57296686 TCTCACATGCAGAAGGCAATGGG + Intronic
1129062763 15:72873515-72873537 CATCAGTCGCAGAAGGAGATTGG + Intergenic
1129075968 15:72996437-72996459 CCTGAGCTACAGAAGGGAATAGG + Intergenic
1129168400 15:73792775-73792797 ATTCAGATGCAGAAGAGGACAGG - Intergenic
1129221076 15:74131866-74131888 CCTTAGATGCAGTAGGGCATGGG + Intronic
1129342980 15:74898131-74898153 CCTCAGCTGCAGAGGAGGAAAGG + Exonic
1129870266 15:78935565-78935587 CCTCAGCTGCATCTGGGGATGGG + Intronic
1131351912 15:91708890-91708912 CCACAGATACACAAGGGAATGGG - Intergenic
1132008981 15:98257505-98257527 CCTCAAATTCAGAAGGGAAATGG - Intergenic
1132592892 16:734053-734075 CCTCTGCTGCAGAAGAGGAAGGG + Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1135584566 16:23658970-23658992 TCTCAGATACAGAGAGGGATAGG - Intronic
1136560982 16:31039093-31039115 TCTCAGCTGCAAAAGGGCATTGG - Intronic
1136621159 16:31429262-31429284 CCCCAGCTGCAGGAGGGGATGGG + Intergenic
1138212589 16:55175773-55175795 CTGCAGATTCAGGAGGGGATGGG + Intergenic
1139670784 16:68491393-68491415 CCTCAGGGGCAGGAGGGGAGGGG + Intergenic
1139673178 16:68505536-68505558 TCTCAGAGGCAGAAGGTGAGGGG + Intergenic
1139681818 16:68570938-68570960 CCTCAGATGCTGAAGGAGCTGGG + Intronic
1139939670 16:70596163-70596185 CCTCAGAGGCAGGAGGGGTGAGG + Intronic
1143647401 17:8239849-8239871 GAGCAGATGCAGAAGGGGAATGG - Intronic
1144464398 17:15485409-15485431 CCTCAGCTACAGAAAGGAATAGG - Intronic
1146085227 17:29822162-29822184 CTGGAGATGCTGAAGGGGATGGG - Intronic
1146484054 17:33229183-33229205 GCTGAGATGGAGGAGGGGATAGG + Intronic
1146894994 17:36534706-36534728 CTTCAGACGCGGAAGGGGCTTGG - Intronic
1149540470 17:57464471-57464493 TCTTAGAAGCAGAAGTGGATAGG + Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152755613 17:82085797-82085819 GCTCAGCTGCAGCAGGGGATGGG + Exonic
1153843119 18:9024582-9024604 GCTCAGATGCAGAAGTAGAATGG + Intergenic
1155294324 18:24371508-24371530 CCTGAGAAGCAGGAAGGGATGGG - Intronic
1155416623 18:25605792-25605814 CCTCAGATTCAGGAGGGCATGGG + Intergenic
1156527254 18:37778594-37778616 CCTCAGGTGCAGAAGGGAGGTGG - Intergenic
1160063551 18:75553304-75553326 CTTCAGAAGGAGAAAGGGATGGG + Intergenic
1166109745 19:40614659-40614681 CTTCAGCTGCAGAGGGGGAATGG - Intronic
1166236406 19:41460249-41460271 CCTAATATCCAGAAGGGGAGAGG - Intergenic
1166237095 19:41464546-41464568 CCTGACATTCAGAAGGGGAGAGG - Intergenic
1166263660 19:41662526-41662548 CAACAGATGCTGAAGAGGATTGG + Intronic
1166317442 19:41997130-41997152 TCTGAGACGCAGAAGGGGACGGG + Intronic
1167217170 19:48172165-48172187 CCAGAGATGCAGAGGGGGAGAGG + Intronic
1168115750 19:54220679-54220701 TCTCAGACGCAGTGGGGGATGGG + Exonic
1168118736 19:54240425-54240447 TCTCAGACGCAGTGGGGGATGGG + Exonic
1168181265 19:54664312-54664334 TCTCAGATGCAGTAGGGGATGGG - Exonic
1168185735 19:54698324-54698346 TCTCAGACACAGCAGGGGATGGG - Intronic
1168523253 19:57069183-57069205 CCTCCCATGGAGAAGGGGAGCGG - Intergenic
925821759 2:7805549-7805571 CCACAGATGCTAAAGGTGATGGG + Intergenic
927589957 2:24346765-24346787 CCTCAGAAGTAGAAGAGTATAGG + Intronic
929334607 2:40725844-40725866 ACCCAGATGCAGAAGAGGAAAGG + Intergenic
929479263 2:42287913-42287935 CATAAGATGCAGAAGGGACTAGG + Intronic
930151642 2:48066230-48066252 ACTCAGATGGTAAAGGGGATAGG + Intergenic
930283577 2:49400682-49400704 CCTCACATACAGATGGAGATAGG + Intergenic
931886771 2:66626237-66626259 CCTCAGAAGCACAAGGGGTTGGG - Intergenic
933736585 2:85500095-85500117 CCTCAAAAGCAGTAGGGGAGAGG - Intergenic
934157229 2:89214740-89214762 CCTCAGCTTCTGAAGGGGAATGG - Intergenic
934210085 2:89968004-89968026 CCTCAGCTTCTGAAGGGGAATGG + Intergenic
935423508 2:102895062-102895084 CCTCAGCGTCTGAAGGGGATAGG + Intergenic
935697229 2:105780770-105780792 CCTCACATGCTGAAGGGGTGAGG - Intronic
935902940 2:107811782-107811804 CCTCAGATGCACAGAGGGCTTGG + Intergenic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
939942571 2:148367826-148367848 CAACAGATTCTGAAGGGGATGGG + Intronic
940291556 2:152082411-152082433 CCTCAGAATCAGTAGGGAATTGG + Intronic
940699606 2:157024290-157024312 CCTCATAGGCAGAAGGGACTTGG + Intergenic
942795497 2:179814148-179814170 CCTCAGGGGCAGAAGGGGCTGGG + Intronic
943648835 2:190435062-190435084 CCTCAGATGGAGAGGGGGGTTGG - Intronic
943880585 2:193139902-193139924 GCTCACAGGCAGAAGGGGCTTGG - Intergenic
944106931 2:196089366-196089388 CCTGAGAAGCACAAGGGGTTAGG + Intergenic
946254516 2:218433007-218433029 CGGGAGATGGAGAAGGGGATGGG + Intronic
946537820 2:220650575-220650597 CAGCAGATGCTGAATGGGATTGG + Intergenic
947465039 2:230336154-230336176 CATCAGATGCATGATGGGATTGG + Intronic
948299374 2:236890524-236890546 GATGAGGTGCAGAAGGGGATGGG + Intergenic
948417781 2:237827308-237827330 CCTCAGATACTGAAGGGCAGAGG - Exonic
1168851440 20:979750-979772 CCCCAAATGCAGAAGGAGCTGGG - Intronic
1169348904 20:4852281-4852303 CCTCAGAATCTGTAGGGGATTGG - Intergenic
1170579647 20:17688144-17688166 TCTCAGGTGCAGATGGGGATGGG + Intergenic
1170817938 20:19730608-19730630 CCTGAGAAGGACAAGGGGATGGG - Intergenic
1170992173 20:21312962-21312984 CCTCAGAACCAGAAGAGGTTTGG + Intronic
1171092015 20:22294237-22294259 CTTCAGATGCAAAAGGTGAGAGG - Intergenic
1172783257 20:37449836-37449858 TTTCAGACGCAGAAGGAGATTGG - Intergenic
1173311821 20:41903537-41903559 CATGAGATGCAGAAGCAGATTGG - Intergenic
1173648255 20:44647103-44647125 TCTCTGATGCAGAGGGGAATTGG - Intronic
1173893381 20:46530843-46530865 TCCCAGATGCAGAAGAGGCTGGG + Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1175876549 20:62232905-62232927 CCTCAGCTGGAGCTGGGGATGGG - Intronic
1179181977 21:39053447-39053469 CCTCAGCAGCAGAGGGGGCTGGG - Intergenic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1181116359 22:20634631-20634653 CCACAGAGCCACAAGGGGATTGG - Intergenic
1183625879 22:39001361-39001383 CCTCAGTTGCTGCAGGGGAGAGG - Intergenic
1183929227 22:41226624-41226646 GCTCAGATGCAGAGGGAGAGGGG - Intronic
1184710529 22:46246968-46246990 CCTCAGCTGATGAAGGGGAGAGG - Intronic
1185391661 22:50564745-50564767 TCTCAGATACACAAGGGCATGGG - Intergenic
949264164 3:2137833-2137855 ACTCAGATGCAGTAGGGGTGGGG - Intronic
949405701 3:3712175-3712197 CCTCAGCTCCTGCAGGGGATTGG - Intronic
951694797 3:25434868-25434890 CATCTGATGCAGATGGGGATGGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955573919 3:60338079-60338101 CCTGAGATGCAGCAGGGGACAGG + Intronic
955766717 3:62351947-62351969 CATCAGTTGCAGAAGGAGAGTGG - Intergenic
956499795 3:69869895-69869917 CCTCAGCTGGAGAAGGACATGGG - Intronic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
959278148 3:104304192-104304214 CCTGGGAGGCAGAAGGGGTTGGG + Intergenic
960701691 3:120445852-120445874 GCTCAGCTGCAGCAGGGGATAGG + Intronic
961633682 3:128319590-128319612 CCTAGGAGGCAGAAGGCGATGGG - Intronic
961882444 3:130071652-130071674 CCACAGATGCAGGACGGGACAGG + Intergenic
962454890 3:135555995-135556017 CCTCAGCTGGAAAAGGGCATTGG + Intergenic
962866101 3:139449082-139449104 CCTCCTAGACAGAAGGGGATGGG + Intergenic
967284138 3:187852364-187852386 CGTCAGAGTGAGAAGGGGATTGG - Intergenic
968816347 4:2823743-2823765 CCTCATAGGCAGGAGGGGCTGGG - Intronic
968920265 4:3518798-3518820 CCTCAGGTGCAGGAGGGGTGGGG + Intronic
969604868 4:8197437-8197459 CCTCAGACGCAGCCGGGGCTGGG + Intronic
970424385 4:15932976-15932998 CTTCAGAGGCAGAAAGGGCTTGG + Intergenic
972279810 4:37590888-37590910 GCTCCGATGGAGATGGGGATGGG + Exonic
972780705 4:42284737-42284759 CCTCAGAAGCAGAAGAGGTTAGG - Intergenic
973628836 4:52799534-52799556 CCTCAGGATCTGAAGGGGATTGG - Intergenic
973777803 4:54259191-54259213 CCTCAGCTGCTCAAGGGGCTGGG - Intronic
976024974 4:80675977-80675999 CCTGAGAAGCACAAGGGGTTGGG - Intronic
978150810 4:105432587-105432609 CAGTAGAGGCAGAAGGGGATAGG + Intronic
980243106 4:130202315-130202337 GCTCATAGGCAGAAGGGGGTGGG + Intergenic
983540468 4:168903901-168903923 CCTCAGGTAAAGAAGGGTATAGG + Exonic
983722148 4:170868804-170868826 CCTTAGGGGTAGAAGGGGATTGG - Intergenic
983938388 4:173518637-173518659 TCCCAGATGCAGCAGGGGCTCGG - Intergenic
985984801 5:3505769-3505791 CCACAGAGACAGAAGGGGCTCGG - Intergenic
987205397 5:15620008-15620030 CCTCAGCTGCAGGTGGGAATGGG + Intronic
987588658 5:19893123-19893145 CCTCAGAGGCAGAGGGGCAGAGG - Intronic
987663690 5:20908361-20908383 CCTGAGATTTAGAAGGGGCTAGG + Intergenic
988758995 5:34293828-34293850 CCTGAGATTTAGAAGGGGCTAGG - Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
994641882 5:102420998-102421020 CCCGAGAAGCAGAAGGGGCTGGG + Intronic
994661823 5:102662980-102663002 ACTGAGATGCAAAAAGGGATGGG - Intergenic
994744949 5:103666565-103666587 TCTCAGAAGCAGAAAGGGAGTGG - Intergenic
995280647 5:110331758-110331780 CCTCACATGTGGAAGGGGAAGGG - Intronic
995401449 5:111746930-111746952 CCTCTGATGCAGAAGGCACTAGG + Intronic
996387923 5:122928359-122928381 CCTTACATGCAGAAGGGACTTGG + Intronic
996702622 5:126465483-126465505 CCACAGATGGGGTAGGGGATTGG - Exonic
997445235 5:133935449-133935471 GCTCAGAGGGAGTAGGGGATGGG + Intergenic
997475923 5:134142430-134142452 CCTCAGAAGTAGGAGGGGGTGGG + Intronic
998068287 5:139176660-139176682 CCTCACATGCAGAAGAGGCAAGG + Intronic
1000958581 5:167571984-167572006 GCTCAGATGTAGAAGGGAAAAGG - Intronic
1001087493 5:168711261-168711283 CCTCAGAAGTGGAAGGGGCTGGG - Intronic
1001667249 5:173443493-173443515 CCCCAGATCTAGAAGTGGATTGG + Intergenic
1002128606 5:177065335-177065357 CCTCTGATGGAGGAGGGGAAAGG - Exonic
1002868930 6:1148139-1148161 CCTCAAATGCAGAAACAGATGGG - Intergenic
1004369917 6:15043546-15043568 CCTCAGGTGCAGGAAGGGACAGG + Intergenic
1004743630 6:18488427-18488449 GCTCAGATACAGAAGGATATAGG + Intergenic
1004767976 6:18752923-18752945 CCACAGAAGCAGAAGGGGAGAGG - Intergenic
1004924231 6:20402984-20403006 CCCCGGATGGAGAAGGGGGTGGG + Intronic
1007425516 6:41743714-41743736 CATCAGATGAAGAAGTGAATGGG + Intronic
1009046368 6:58241259-58241281 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1009222185 6:60995576-60995598 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1009226640 6:61025752-61025774 CCTAATATCCAGAAGGGGAGAGG - Intergenic
1009228564 6:61038733-61038755 CCTAATATGCAGAAGGGTAGAGG - Intergenic
1011909673 6:92420939-92420961 CCTCGGAAGCACAAGGGGTTGGG + Intergenic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1012775652 6:103490875-103490897 CCTCATATGCAAAAGGGGAGAGG + Intergenic
1013248882 6:108314693-108314715 TCTAAGAAGCAGAAGGGGTTTGG - Intronic
1013599737 6:111692738-111692760 CCTCAGACTCAGAAGGAGAGTGG - Intronic
1014815189 6:125927803-125927825 CCTCAGTTGGGGAAGGGGATAGG + Intronic
1015943915 6:138480142-138480164 CCTCTGTATCAGAAGGGGATTGG + Intronic
1016088326 6:139943586-139943608 CATCAGAATCAGAAGGGGGTGGG + Intergenic
1016619606 6:146092723-146092745 CTTCAGATGCAGCAGGGGCCAGG - Intronic
1016624702 6:146152990-146153012 CCTAAGTGGCAGAATGGGATTGG + Intronic
1017834921 6:158168367-158168389 CCACAGATGCAGAAGCGCCTCGG - Exonic
1018393778 6:163361349-163361371 TTGCAGATGCAGAAGGGGAGAGG - Intergenic
1019601967 7:1889318-1889340 CCTCAGATGCTGAGGAGGCTGGG + Intronic
1020035850 7:4962753-4962775 CCTCATCGGCAGGAGGGGATAGG - Intergenic
1020336318 7:7065058-7065080 CCTAATATCCAGAAGGGGAGAGG + Intergenic
1020428516 7:8095809-8095831 CCTTGGAAGCAGAAGGGGTTGGG + Intergenic
1020731064 7:11881264-11881286 CCTCAGAAGCAGTAGGAGAATGG + Intergenic
1022719600 7:32931030-32931052 CCTCAGCTGCAGAAAGGAACAGG - Intergenic
1024450689 7:49539419-49539441 ACGCAGAAGCAGAAGGAGATGGG + Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1028892949 7:96009327-96009349 CCTCAGATGCTAATGGGGACAGG - Intronic
1029176131 7:98665837-98665859 CTGCAGATGCAGCAGGGAATAGG - Intergenic
1030531696 7:110718783-110718805 CCTCAGATGCAGATAGAGGTTGG + Intronic
1032681686 7:134191102-134191124 CCTCAGGTGGTGGAGGGGATGGG + Intronic
1032684902 7:134223417-134223439 TCTCAGAGGCAGCAGGGGGTAGG + Intronic
1037524758 8:19713861-19713883 CCCCAGATGGAGAAGGGGACTGG + Intronic
1038134043 8:24766675-24766697 ATTCAGAGGCAGAAGGGGAGGGG + Intergenic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1042725134 8:71867283-71867305 CCTCAGATGCAGAAATGACTAGG + Intronic
1043551421 8:81377103-81377125 CCTCAGAGGCAAGAGGAGATTGG + Intergenic
1043633525 8:82365472-82365494 CCTAATATCCAGAGGGGGATAGG + Intergenic
1044928231 8:97227256-97227278 CCTCAGAGGAAGAAGGGCAAAGG + Intergenic
1047963302 8:130026662-130026684 CCTGAGCTGCAGAAAGGAATAGG - Intergenic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1049731181 8:144179328-144179350 CCTCAAGTGCAGGAGGGGAGGGG - Intronic
1050137841 9:2486728-2486750 CCTCAGATTCAGAATGAAATTGG - Intergenic
1050382391 9:5042973-5042995 CCTCAGAAGCTGAGGGGGGTGGG + Intronic
1050947160 9:11539477-11539499 CCTCAGTTTGAGCAGGGGATTGG + Intergenic
1051118800 9:13729149-13729171 TCTCACATGCACAAGGGGAGAGG - Intergenic
1051372807 9:16372678-16372700 CCTCAGATGGGGAAAGGGTTGGG + Intergenic
1053593011 9:39533269-39533291 CCTCTTATGCAGACTGGGATGGG - Intergenic
1053850749 9:42287977-42287999 CCTCTTATGCAGACTGGGATGGG - Intergenic
1054573295 9:66832008-66832030 CCTCTTATGCAGACTGGGATGGG + Intergenic
1056272344 9:84958652-84958674 CCTCTGTTGCAGATGGGAATGGG + Intronic
1056459968 9:86800142-86800164 ACTCAAATGCAGAAAGGGTTGGG + Intergenic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1058521250 9:105815848-105815870 CCTGATATCCAGAAGGGGAGAGG - Intergenic
1058814520 9:108670977-108670999 CCTGAGATGCAGGTGGGGAGGGG - Intergenic
1060008135 9:120018543-120018565 GCTCAGATGGAGAATGGGTTGGG + Intergenic
1061380722 9:130255269-130255291 CCTCAGCTGCAGGAGAGGATGGG + Intergenic
1061417343 9:130454283-130454305 CCTGAGAAGCAGAAGCGGAGAGG - Exonic
1061958862 9:133977887-133977909 CCTCAGCTGGCAAAGGGGATGGG + Intronic
1062018386 9:134303864-134303886 GCCCAGATCCAGAAGGGGAGAGG - Intergenic
1062022981 9:134327758-134327780 CCTCACATCCAGGAGGGGCTAGG - Intronic
1062605221 9:137344479-137344501 CCGCAGATGCTGAAGTGGACAGG - Intronic
1186021020 X:5255898-5255920 CCTCTGATGCAGGAGAGCATGGG + Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1192230386 X:69260592-69260614 CCTCAGTAGCAGAAGGGGCAAGG + Intergenic
1196067593 X:111482035-111482057 CCTCAGAAACAAAAGGGCATGGG + Intergenic
1197135215 X:123052524-123052546 CAACAGATGCTGGAGGGGATAGG + Intergenic
1200062267 X:153488870-153488892 CCTCAGCTGCAGGAGGGCAGGGG + Intronic
1201072956 Y:10166005-10166027 CCTGGGATGCAGAAGGGGTCAGG - Intergenic
1201652570 Y:16306719-16306741 CCTCTGATGCAGGAGGGCATGGG + Intergenic