ID: 1042407690

View in Genome Browser
Species Human (GRCh38)
Location 8:68423979-68424001
Sequence CTAGTCCTGCCCTTGACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042407684_1042407690 0 Left 1042407684 8:68423956-68423978 CCCCATGATCTGATTACCTCCAC 0: 13
1: 36
2: 260
3: 1030
4: 4273
Right 1042407690 8:68423979-68424001 CTAGTCCTGCCCTTGACACATGG No data
1042407683_1042407690 1 Left 1042407683 8:68423955-68423977 CCCCCATGATCTGATTACCTCCA 0: 13
1: 37
2: 328
3: 1770
4: 9245
Right 1042407690 8:68423979-68424001 CTAGTCCTGCCCTTGACACATGG No data
1042407685_1042407690 -1 Left 1042407685 8:68423957-68423979 CCCATGATCTGATTACCTCCACC 0: 13
1: 34
2: 245
3: 955
4: 3286
Right 1042407690 8:68423979-68424001 CTAGTCCTGCCCTTGACACATGG No data
1042407686_1042407690 -2 Left 1042407686 8:68423958-68423980 CCATGATCTGATTACCTCCACCT 0: 18
1: 35
2: 270
3: 900
4: 2716
Right 1042407690 8:68423979-68424001 CTAGTCCTGCCCTTGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042407690 Original CRISPR CTAGTCCTGCCCTTGACACA TGG Intronic
No off target data available for this crispr