ID: 1042411908

View in Genome Browser
Species Human (GRCh38)
Location 8:68475817-68475839
Sequence CTCCCTGTGATGTGAGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042411906_1042411908 18 Left 1042411906 8:68475776-68475798 CCAGTGTTCTCTGGGTCTAATGC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1042411908 8:68475817-68475839 CTCCCTGTGATGTGAGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042411908 Original CRISPR CTCCCTGTGATGTGAGGTAG TGG Intronic
No off target data available for this crispr