ID: 1042422766

View in Genome Browser
Species Human (GRCh38)
Location 8:68611354-68611376
Sequence CTGCATTTCTTTTGGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042422763_1042422766 0 Left 1042422763 8:68611331-68611353 CCTTGGTTGTCAATTCAGTTCAA 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1042422766 8:68611354-68611376 CTGCATTTCTTTTGGAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042422766 Original CRISPR CTGCATTTCTTTTGGAAAAA GGG Intronic
No off target data available for this crispr