ID: 1042423580

View in Genome Browser
Species Human (GRCh38)
Location 8:68620340-68620362
Sequence GGGTTGGCATTCAGAGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042423573_1042423580 -2 Left 1042423573 8:68620319-68620341 CCAGAGTCCAGGAAGAGGTTGGG 0: 1
1: 0
2: 3
3: 45
4: 309
Right 1042423580 8:68620340-68620362 GGGTTGGCATTCAGAGGGTCTGG No data
1042423577_1042423580 -9 Left 1042423577 8:68620326-68620348 CCAGGAAGAGGTTGGGGTTGGCA 0: 1
1: 1
2: 2
3: 36
4: 274
Right 1042423580 8:68620340-68620362 GGGTTGGCATTCAGAGGGTCTGG No data
1042423565_1042423580 25 Left 1042423565 8:68620292-68620314 CCAGAGGGTGTGGCATCCCAGCC 0: 1
1: 0
2: 3
3: 20
4: 179
Right 1042423580 8:68620340-68620362 GGGTTGGCATTCAGAGGGTCTGG No data
1042423569_1042423580 8 Left 1042423569 8:68620309-68620331 CCAGCCTAGGCCAGAGTCCAGGA 0: 1
1: 0
2: 3
3: 59
4: 516
Right 1042423580 8:68620340-68620362 GGGTTGGCATTCAGAGGGTCTGG No data
1042423567_1042423580 9 Left 1042423567 8:68620308-68620330 CCCAGCCTAGGCCAGAGTCCAGG 0: 1
1: 0
2: 6
3: 37
4: 352
Right 1042423580 8:68620340-68620362 GGGTTGGCATTCAGAGGGTCTGG No data
1042423570_1042423580 4 Left 1042423570 8:68620313-68620335 CCTAGGCCAGAGTCCAGGAAGAG 0: 1
1: 1
2: 3
3: 44
4: 420
Right 1042423580 8:68620340-68620362 GGGTTGGCATTCAGAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042423580 Original CRISPR GGGTTGGCATTCAGAGGGTC TGG Intronic
No off target data available for this crispr