ID: 1042423600

View in Genome Browser
Species Human (GRCh38)
Location 8:68620457-68620479
Sequence CTGTATTACCAGAGTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042423595_1042423600 19 Left 1042423595 8:68620415-68620437 CCATGCTGAGGACAGGCCGGGTC 0: 1
1: 0
2: 1
3: 6
4: 178
Right 1042423600 8:68620457-68620479 CTGTATTACCAGAGTGAGCAAGG No data
1042423599_1042423600 -10 Left 1042423599 8:68620444-68620466 CCAGGGAGAAGAGCTGTATTACC 0: 1
1: 0
2: 2
3: 17
4: 127
Right 1042423600 8:68620457-68620479 CTGTATTACCAGAGTGAGCAAGG No data
1042423598_1042423600 3 Left 1042423598 8:68620431-68620453 CCGGGTCTAGTCACCAGGGAGAA 0: 1
1: 0
2: 1
3: 4
4: 125
Right 1042423600 8:68620457-68620479 CTGTATTACCAGAGTGAGCAAGG No data
1042423592_1042423600 24 Left 1042423592 8:68620410-68620432 CCTGGCCATGCTGAGGACAGGCC 0: 1
1: 0
2: 3
3: 29
4: 312
Right 1042423600 8:68620457-68620479 CTGTATTACCAGAGTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042423600 Original CRISPR CTGTATTACCAGAGTGAGCA AGG Intronic
No off target data available for this crispr