ID: 1042424326

View in Genome Browser
Species Human (GRCh38)
Location 8:68629325-68629347
Sequence TCTCCATCTTACCACTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042424326_1042424328 -8 Left 1042424326 8:68629325-68629347 CCCTAAAAGTGGTAAGATGGAGA 0: 1
1: 1
2: 0
3: 14
4: 144
Right 1042424328 8:68629340-68629362 GATGGAGAAGCCTGTTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042424326 Original CRISPR TCTCCATCTTACCACTTTTA GGG (reversed) Intronic
902595267 1:17505332-17505354 TCTTCATCTCAGCACTTTTCTGG + Intergenic
908323262 1:62998810-62998832 TCTACATTTTACCAATTTTAAGG - Intergenic
913707708 1:121443667-121443689 TCTCAATCTTACCACACTTTAGG + Intergenic
914963449 1:152228428-152228450 TCTCCATTTGTCCACTTTAATGG - Intergenic
917772775 1:178298095-178298117 TGTCATTCTTCCCACTTTTAAGG + Intronic
921939895 1:220828496-220828518 GCACCATCTTACCTATTTTATGG - Intergenic
922392312 1:225157336-225157358 TCTTCATCATACCACTTTTTTGG - Intronic
922594961 1:226806540-226806562 GCTCCATCCTTCCAGTTTTACGG + Intergenic
923010872 1:230086508-230086530 TCTCCATTTTACAGTTTTTAGGG + Intronic
1063642014 10:7839355-7839377 TCTCCATTTCACCATTTTTTTGG + Intronic
1064121717 10:12624813-12624835 TCTTCATTTTACTCCTTTTACGG + Intronic
1064672079 10:17725491-17725513 TCTTCATCTTACGTCTTGTAAGG + Intergenic
1064774269 10:18758102-18758124 TCTCAATCTTACCATTTCCATGG - Intergenic
1068756953 10:60666549-60666571 TCACCATCTTAACTATTTTAAGG - Intronic
1070166787 10:73904935-73904957 TTTACATCTTAACACCTTTAAGG - Intergenic
1072162558 10:92781931-92781953 TCACCATCTTACGAGTTTAAAGG - Intergenic
1074463806 10:113664627-113664649 TCTTCATATCACCTCTTTTAAGG - Intergenic
1074840560 10:117346735-117346757 TTTCCTTGTCACCACTTTTAGGG + Intronic
1075078400 10:119366837-119366859 TCTGCATCTTTTAACTTTTAAGG - Intronic
1075271473 10:121055529-121055551 CCTCCAACTTACCTCTTTCAAGG - Intergenic
1075489653 10:122855761-122855783 TTCCCATCTCACCACTTCTAAGG + Exonic
1078138408 11:8671939-8671961 CCTCCATCTGTCCACTCTTAGGG + Intergenic
1078462510 11:11525311-11525333 CCTCCATTCTACCACTTCTAGGG - Intronic
1079476868 11:20840422-20840444 TCTCTATTCTACCACTTTTGTGG + Intronic
1080863225 11:36168793-36168815 TCTCCATGCTACCATTGTTAAGG - Intronic
1082226137 11:49709801-49709823 TTTCCATCTTAACCATTTTAAGG - Intergenic
1082849307 11:57751752-57751774 TCTTCAAGTTAACACTTTTAAGG + Exonic
1085109901 11:73878345-73878367 TCTTCACCCTAGCACTTTTAGGG - Intronic
1086212519 11:84337832-84337854 TCTCCAACATACCACTATTAAGG + Intronic
1091252963 11:134159299-134159321 TCTCCATTTTAACACTTTATTGG + Intronic
1091324148 11:134671523-134671545 TCTCCATCTTCACACTTCTCAGG - Intergenic
1096176989 12:49528460-49528482 TATCCATCTTTCCACTTCTCAGG + Intergenic
1096580447 12:52581436-52581458 TCTCCATCTTCCCATTGTCATGG + Intergenic
1097061976 12:56292003-56292025 TTTTCATCTTACCACATTTGAGG - Intronic
1098163458 12:67669785-67669807 TCTCCATCTCCCCACATTCACGG - Intergenic
1098757342 12:74382528-74382550 TCCTCTTCTTACCACTTTTCTGG - Intergenic
1100103317 12:91137304-91137326 TCTCATTCTCACCACTTTTGGGG + Intergenic
1102454134 12:113061084-113061106 TCTCAATAGTACCCCTTTTATGG + Intronic
1104362552 12:128147748-128147770 TCTCCATTTTAACACTTCTCTGG - Intergenic
1106535148 13:30633892-30633914 TTTCCATCTTAACACTTATCAGG + Intronic
1108152622 13:47552094-47552116 TCTTCTTATTACCACTTTTTAGG + Intergenic
1110176673 13:72564782-72564804 TCTTCATTGTACCACATTTAAGG - Intergenic
1110287112 13:73762477-73762499 CCTCCAACTTAACACTATTAAGG - Intronic
1115770406 14:36660484-36660506 TCTCCAGATTCCCACTTCTATGG - Intronic
1121807061 14:96837044-96837066 TCTGCATCTTACCACTGAAATGG + Intronic
1122051572 14:99064553-99064575 TACCCATCCCACCACTTTTAGGG - Intergenic
1127394480 15:58532940-58532962 TCTCCTTCTAACTAATTTTAAGG + Intronic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1131566547 15:93491119-93491141 TCTTCATCTTGACACTTTTGAGG - Intergenic
1131902132 15:97099428-97099450 ACTCCATCTTCACGCTTTTAAGG + Intergenic
1134355589 16:13479196-13479218 TCTCCAGCTTCCCTCTTTTAAGG + Intergenic
1140332440 16:74070869-74070891 TCCCCACCTTGCCACTTTTGTGG - Intergenic
1142939099 17:3366603-3366625 TCTCTACCTTACCCCTATTATGG + Intergenic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1143617684 17:8063732-8063754 TCTTTATCTTCCCACTTTAATGG - Intergenic
1144186255 17:12798771-12798793 TCTCCATCTTACCATTCTATAGG - Intronic
1144600447 17:16608242-16608264 TCTCCATCTCACAACTTTCTGGG - Intergenic
1145961193 17:28887381-28887403 TCTCCTTCTTACACCTTTTCTGG - Intronic
1146646456 17:34580132-34580154 TCTGCATCTTACAGCGTTTATGG + Intergenic
1148165604 17:45482253-45482275 TCTCCATCTTATCACCAATAAGG + Intronic
1149012033 17:51866692-51866714 CCTTCATTATACCACTTTTAGGG + Intronic
1150396831 17:64828971-64828993 TCTCCATCTTATCACCAATAAGG + Intergenic
1150818822 17:68418139-68418161 TGTCCAGCTTACAATTTTTAAGG - Intronic
1158024011 18:52874579-52874601 TCTACATCATATCTCTTTTATGG + Intronic
1165325978 19:35115004-35115026 GCTCCCTCCTACCACTCTTAAGG - Intergenic
1166947863 19:46408317-46408339 ACTCCATCTTGCCACTTGTTTGG + Intergenic
926781538 2:16476921-16476943 TCTCCACTATACTACTTTTAGGG - Intergenic
929471128 2:42194040-42194062 TTTCCCTTTTACCATTTTTAGGG + Intronic
932682854 2:73841489-73841511 TCTCCATCTCTACAATTTTATGG + Intronic
933210324 2:79559583-79559605 TCACCATCTTCACAGTTTTATGG - Intronic
933592151 2:84244975-84244997 TCTCTAGCTTACCACTCTGATGG + Intergenic
935548763 2:104429801-104429823 TCTCCATTTTAACACTTTTCAGG - Intergenic
935575484 2:104705379-104705401 TCTCCATTTTTCTACTTTAAAGG + Intergenic
941486478 2:166088330-166088352 TCTCCATCTAACCATTTTTGTGG + Intronic
942242932 2:173980275-173980297 CCTCCATTTTAGAACTTTTAAGG + Intergenic
943355956 2:186856189-186856211 ACTCCATCTGTCCTCTTTTAGGG - Intergenic
945004060 2:205384327-205384349 TCTCTGTCTTTCCATTTTTATGG - Intronic
945053936 2:205851380-205851402 TCTCCATCTTCCCAAATCTATGG + Intergenic
945588039 2:211691850-211691872 TCTCCATCTCACCAGTTTACAGG - Intronic
945643072 2:212455063-212455085 TCTCCATCTTCCCACCTTTGGGG + Intronic
946038554 2:216764457-216764479 TCTGCCTCTTTCTACTTTTAAGG + Intergenic
946498497 2:220220341-220220363 GTTCCATCTTTCCACTTTCAAGG - Intergenic
1170137918 20:13095578-13095600 TCTCCAGCTTAAGGCTTTTAGGG + Intronic
1171176504 20:23053961-23053983 TCTTCATCCTAACACTTTGAAGG - Intergenic
1173187289 20:40850177-40850199 TCTCAATCTTAGCACTTGTTTGG - Intergenic
1176933283 21:14839776-14839798 TCACCATGTTATCCCTTTTAAGG - Intergenic
1178637212 21:34314687-34314709 TCTCCTTCTTCCATCTTTTAAGG - Intergenic
1179146937 21:38776249-38776271 TGTCTATCTTACCTCTTTGAAGG - Intergenic
1179936328 21:44607024-44607046 TCACCAACTTACCATTTTTCTGG - Intronic
1182939126 22:34257512-34257534 ACTCCCTTTTACCACTTTTTGGG + Intergenic
1184222779 22:43111237-43111259 ACGCCATCTTCCCTCTTTTAAGG - Intronic
1184427833 22:44423553-44423575 TCTCCATCTTCCCAGCTTTCAGG - Intergenic
949377078 3:3402245-3402267 TCGCCATCTTACTAATTTTTTGG - Intergenic
953105136 3:39870244-39870266 TCTCCTTCTTCCCTCTTTCAGGG - Intronic
953585078 3:44192449-44192471 TCTCCATCTTACCTCTTTCTGGG - Intergenic
955942109 3:64156451-64156473 TCTAAATCTGACCACTTTTATGG - Intronic
956705227 3:71993792-71993814 TCTCCTCCTTCCCACTTTTCTGG - Intergenic
960614245 3:119582303-119582325 TCTCCACCTTCCCACGTCTAGGG - Exonic
961048367 3:123725267-123725289 GCTCCATCTTATCAGTTTAATGG + Intronic
965392814 3:168126216-168126238 TCTGCATCCTGCTACTTTTAGGG - Intergenic
966128525 3:176608391-176608413 TCTGTATCTTACCTCCTTTAGGG + Intergenic
967785248 3:193486403-193486425 TTTCCACCCTACCACTATTACGG - Intronic
968154576 3:196369147-196369169 TGTTCATCTTACCTTTTTTAAGG - Intronic
974584981 4:63862057-63862079 TCTATATGTTACCTCTTTTATGG - Intergenic
974745184 4:66063552-66063574 TATCCACCTTACTAATTTTAAGG - Intergenic
975035873 4:69679861-69679883 TCTCCATGATATCAATTTTAAGG + Intergenic
975644493 4:76532683-76532705 TTTCCATCTTCCCAATTTCATGG + Intronic
982103599 4:151992484-151992506 TTTCCATCATACATCTTTTAGGG + Intergenic
982302411 4:153893078-153893100 TCTTCATCTTATCACTCTGATGG - Intergenic
984391767 4:179143100-179143122 TCTCCATCATATCACTATTTTGG - Intergenic
985359515 4:189157018-189157040 ACTTCCTCTTACCAGTTTTAAGG + Intergenic
986017968 5:3774755-3774777 TCTCCATGTTCCCCCATTTATGG + Intergenic
988260469 5:28881022-28881044 TCTCTATATTACTATTTTTATGG + Intergenic
990194301 5:53295935-53295957 TCTCCATCATACAACTTTATTGG + Intergenic
990786218 5:59423478-59423500 TTTCCATCATGCCACTCTTAGGG + Intronic
993845670 5:92940196-92940218 TCTCCCTCTTATTATTTTTAGGG + Intergenic
994713745 5:103297246-103297268 TCTTCAGCCTACCATTTTTATGG - Intergenic
995342154 5:111071940-111071962 TCTTCATCTTACAACTTGTAGGG + Exonic
999109308 5:149104168-149104190 GCTCCAGCTCCCCACTTTTAGGG - Intergenic
999928147 5:156402278-156402300 TGTCAATAATACCACTTTTAGGG - Intronic
1004221141 6:13747459-13747481 TCTCCATCTTACCTGATTTCTGG - Intergenic
1009754683 6:67921685-67921707 TATCCTTCTGGCCACTTTTATGG + Intergenic
1011794432 6:90937067-90937089 TCTCCATCTCACCCCTCTGAAGG - Intergenic
1012608143 6:101183483-101183505 TTTCCATCTTTCAACTTGTAAGG - Intergenic
1014593656 6:123305457-123305479 TTCTCATTTTACCACTTTTATGG - Intronic
1014704995 6:124735121-124735143 TACACATCTTACCATTTTTAAGG - Intronic
1014918199 6:127179897-127179919 TCTTCCACTTTCCACTTTTAAGG + Intronic
1014940279 6:127430082-127430104 TCAACATCTTATCACTTTGAGGG - Intergenic
1015477592 6:133670941-133670963 TCTCCATCAAACCACATTTTGGG + Intergenic
1016056157 6:139579730-139579752 TCTCCATCTCACCACATAAAAGG + Intergenic
1018107157 6:160499974-160499996 GCTCCATCTCTCCACTCTTAGGG + Intergenic
1018115680 6:160582316-160582338 TTTCCTTCTTACCACTCTGAAGG + Intronic
1018693619 6:166371122-166371144 TCTCCAACTTACCACTTTTAAGG - Intronic
1020363805 7:7358064-7358086 TCTCCCTATTACCACTTTCAGGG + Exonic
1027479810 7:78681558-78681580 TCTACATCTTTCCACTTCCAAGG + Intronic
1027601169 7:80243363-80243385 TCTCAATTTTACCACTTTAAGGG - Intergenic
1027912807 7:84274364-84274386 TCTCCCTCTTCCCACAATTAAGG + Intronic
1028409779 7:90517094-90517116 TCTAAATATTACCACTTTTCTGG + Intronic
1030291502 7:107877354-107877376 TCTGCCTCTAACCATTTTTACGG - Intergenic
1030629097 7:111875605-111875627 TGACCATCTTACATCTTTTAAGG - Intronic
1032832674 7:135644032-135644054 ACTCCCTCTTGCCACTTTTCTGG + Intronic
1041423102 8:57691718-57691740 TCTCTGTCTTACTACATTTAGGG + Intergenic
1042424326 8:68629325-68629347 TCTCCATCTTACCACTTTTAGGG - Intronic
1043149722 8:76699862-76699884 TCTGCATAATACCACTTTGATGG + Intronic
1043707986 8:83377718-83377740 TCTCCATCTTGCCACATTGTGGG - Intergenic
1048247971 8:132830263-132830285 CCTCCATCCTTTCACTTTTAAGG + Intronic
1050301025 9:4259171-4259193 TCTCCATATTACCAGTTTCTAGG - Intronic
1050459997 9:5869538-5869560 TCTCTAGCTTCCCACTTTTGGGG + Intergenic
1051780913 9:20688039-20688061 TCTCTATCTTAACACATTAAGGG - Intronic
1052656172 9:31364053-31364075 TCTATATCTTACCTTTTTTAGGG - Intergenic
1055122025 9:72671517-72671539 ATTCCATTTTACCACCTTTATGG - Intronic
1057606552 9:96501945-96501967 TCTTCCCCTTACCCCTTTTAAGG - Exonic
1062090244 9:134673378-134673400 GCAGCATCTTAGCACTTTTATGG - Intronic
1188260685 X:28019390-28019412 TCACCATCTTAACAGGTTTAAGG + Intergenic
1188518683 X:31014295-31014317 TCTCTATCTCACTTCTTTTATGG + Intergenic
1189730151 X:44011713-44011735 TCTGCCTCCTTCCACTTTTAAGG + Intergenic
1191163517 X:57362040-57362062 GCTCCATCTTACCGATTTTATGG + Intronic
1192290676 X:69791499-69791521 TCTACATCTTATCCCTCTTATGG - Intronic
1193964904 X:87973301-87973323 TCTCCATCTTACCACATTATTGG + Intergenic
1197797608 X:130315128-130315150 TTTGCATCTTAACAATTTTAAGG + Intergenic