ID: 1042430752

View in Genome Browser
Species Human (GRCh38)
Location 8:68703699-68703721
Sequence GGCTCCTCAAAAATTCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042430747_1042430752 8 Left 1042430747 8:68703668-68703690 CCTTTCATCCTTCAGTGGGCACA 0: 1
1: 0
2: 11
3: 79
4: 655
Right 1042430752 8:68703699-68703721 GGCTCCTCAAAAATTCTTGTGGG No data
1042430748_1042430752 0 Left 1042430748 8:68703676-68703698 CCTTCAGTGGGCACACCTCATTA 0: 1
1: 0
2: 1
3: 11
4: 105
Right 1042430752 8:68703699-68703721 GGCTCCTCAAAAATTCTTGTGGG No data
1042430744_1042430752 28 Left 1042430744 8:68703648-68703670 CCTATGAATAAATGCTTTGTCCT 0: 1
1: 0
2: 1
3: 22
4: 220
Right 1042430752 8:68703699-68703721 GGCTCCTCAAAAATTCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042430752 Original CRISPR GGCTCCTCAAAAATTCTTGT GGG Intronic
No off target data available for this crispr