ID: 1042433334

View in Genome Browser
Species Human (GRCh38)
Location 8:68734600-68734622
Sequence TACAATAATGGCAATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042433334_1042433338 -5 Left 1042433334 8:68734600-68734622 CCCACCTCATTGCCATTATTGTA 0: 1
1: 0
2: 2
3: 17
4: 203
Right 1042433338 8:68734618-68734640 TTGTAGAAACCTCTTCCTACAGG No data
1042433334_1042433342 30 Left 1042433334 8:68734600-68734622 CCCACCTCATTGCCATTATTGTA 0: 1
1: 0
2: 2
3: 17
4: 203
Right 1042433342 8:68734653-68734675 TTTCTCCTAGTTAATAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042433334 Original CRISPR TACAATAATGGCAATGAGGT GGG (reversed) Intronic
900861815 1:5239087-5239109 GACAATAATGGCAGTGTGCTGGG + Intergenic
903143799 1:21356661-21356683 TACAATGAAGGAAATGAGGTGGG - Intergenic
906222135 1:44089113-44089135 TAAAATAAGGGCAATAAGGCAGG + Intergenic
906367245 1:45221177-45221199 GAAAATAATGGCAATGAGAATGG + Intronic
909013658 1:70360679-70360701 TTTCATAATGGGAATGAGGTGGG + Intronic
909962409 1:81862839-81862861 TACAATAGTGTGAATGGGGTAGG - Intronic
910023277 1:82618980-82619002 TAGCAGAATGGCAATGAAGTAGG + Intergenic
910050723 1:82971048-82971070 TAAAATAAGGGCATTAAGGTGGG + Intergenic
915956316 1:160223310-160223332 TACAATATTGGCCATGAGACTGG + Intronic
918155999 1:181847351-181847373 TACAATGATGGAACAGAGGTAGG - Intergenic
921585708 1:216943848-216943870 TTCAATAAAGGCAATCAGGCAGG + Intronic
922540299 1:226414129-226414151 TACAATAAACGCAGTGAGCTCGG - Intergenic
922631920 1:227124105-227124127 TACAATACTGGCAATAAGCTTGG + Intronic
923570326 1:235107693-235107715 TAAAATAGTGGCAGTGAGGCTGG + Intergenic
923917658 1:238527483-238527505 ATCAATAATGACAATGTGGTGGG - Intergenic
1063271420 10:4513875-4513897 TACTGAAATGGCAATGAAGTTGG - Intergenic
1064130994 10:12709379-12709401 TTCAACAATGGCAAAGAGGTGGG - Intronic
1066425240 10:35302255-35302277 TAGAAAAATAGCAATGAGGATGG - Intronic
1068418729 10:56761661-56761683 TATTTTAATGGCAATGTGGTTGG + Intergenic
1069200742 10:65612538-65612560 TACAACTATGGTAATCAGGTAGG - Intergenic
1071451233 10:85792904-85792926 CACAATGATGGCAGTGAGGAAGG + Intronic
1075552233 10:123401011-123401033 TACAAGTATGGGAATGAGGGAGG + Intergenic
1076065733 10:127446481-127446503 CACAATAATAGCAAAGAAGTAGG + Intronic
1077678942 11:4221996-4222018 TAGAATATTGGCATTGAGGGGGG + Intergenic
1077889540 11:6409005-6409027 TACAATAATGATATTGTGGTGGG + Intronic
1078488674 11:11748710-11748732 ATCAATATTGGCAAGGAGGTGGG + Intergenic
1081649750 11:44815856-44815878 ACCAGTAAAGGCAATGAGGTGGG + Intronic
1082910960 11:58374083-58374105 TACATTAAAGGCATTGAGATGGG + Intergenic
1085654241 11:78298092-78298114 TATAATAATTGCATTGAAGTAGG + Intronic
1085829152 11:79881163-79881185 CACAATAATACCTATGAGGTAGG + Intergenic
1085865275 11:80283347-80283369 TACAGTAATGGAAATGGGGAAGG - Intergenic
1086375521 11:86196054-86196076 CACAAGAAAGGCAATTAGGTAGG - Intergenic
1086809103 11:91282742-91282764 TACAATTGTGGCAATTAAGTTGG + Intergenic
1087092895 11:94293202-94293224 TACAGAAAAGGAAATGAGGTGGG + Intergenic
1088376753 11:109149440-109149462 TACAATAATGGCCTTGGAGTAGG + Intergenic
1089228095 11:116943995-116944017 AAAAATAATAGCAATGAGATAGG + Intronic
1090743318 11:129686916-129686938 TACAAAAATGGCAATAACGTAGG + Intergenic
1098814225 12:75137174-75137196 TACTTAAATGTCAATGAGGTAGG - Intronic
1101071951 12:101084942-101084964 GACAAGGATGGCAATGAGGTAGG - Intronic
1101476500 12:105054524-105054546 TACCATACTTGCAATGAAGTTGG - Intronic
1103116363 12:118336773-118336795 TACAAAAAGGGCAAAGAGGCTGG + Intronic
1105564533 13:21531112-21531134 CACAAGAAAGGCAATTAGGTAGG - Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106402163 13:29441388-29441410 AACAACAATGGCAAAGAGGAAGG - Intronic
1109836181 13:67860297-67860319 GACAATAATGTCAAAGAGGAAGG - Intergenic
1110051481 13:70906654-70906676 TACTATCAAGACAATGAGGTAGG + Intergenic
1111919485 13:94395780-94395802 AACAGTAATGGCAATTAGGTAGG + Intronic
1114769970 14:25418046-25418068 TAAAATAATGGCAAGGCTGTTGG + Intergenic
1117303811 14:54453590-54453612 TCCAAGAAAGGCAATGAGGCAGG + Intergenic
1117565493 14:56990372-56990394 CCCAATGGTGGCAATGAGGTGGG + Intergenic
1118797783 14:69159007-69159029 TACATAAATGGCAATAAGGCTGG - Intergenic
1121076095 14:91069574-91069596 TAAAATAAATGCAATGAGGCTGG - Intronic
1121310637 14:92933423-92933445 TCCAATCATGGTAATGACGTGGG - Intronic
1124733396 15:32220318-32220340 TACATAAAAGGAAATGAGGTGGG - Intergenic
1131266695 15:90919683-90919705 TACAGTAACGTCAAGGAGGTTGG - Exonic
1136249311 16:28993515-28993537 TACAATAATCAGAATGAGGACGG - Intergenic
1138570067 16:57864800-57864822 TCCAATAAAGGTAAAGAGGTTGG - Intergenic
1138807702 16:60109997-60110019 TACAAAAATGACAATGATTTAGG - Intergenic
1141544136 16:84752387-84752409 TACACCAATGGCAATGACTTTGG + Intronic
1143368021 17:6421081-6421103 TACATTAAGGGCCTTGAGGTGGG + Intronic
1145710259 17:26964810-26964832 AACAAAAATGGCAAGCAGGTAGG - Intergenic
1146926928 17:36751706-36751728 GACAAGAATGGGGATGAGGTGGG - Intergenic
1149225822 17:54469297-54469319 TACTATAAAGTCAATGAGATAGG + Intergenic
1150036496 17:61805456-61805478 TCCAAAGATGGCATTGAGGTAGG - Intronic
1150519087 17:65847834-65847856 TAGAATGATGTCAAGGAGGTTGG + Intronic
1155433335 18:25785172-25785194 CAAAATAATGGCAATTAGGCTGG + Intergenic
1155594934 18:27474761-27474783 TCCAATAATGGCAATGGTGCTGG + Intergenic
1155838067 18:30612477-30612499 AACAATTATGGCAAAGGGGTTGG + Intergenic
1155941007 18:31802023-31802045 TTGAATAAAGGCAATGAGGGTGG - Intergenic
1157035285 18:43965234-43965256 TACAATCACGGCAATTAAGTTGG - Intergenic
1157080560 18:44520559-44520581 CACAAGAATGGCAAACAGGTTGG - Intergenic
1157394927 18:47333596-47333618 TACAACAGTGGAAATTAGGTGGG + Intergenic
1158322107 18:56274876-56274898 AAAAATAATGGCAACGAGATAGG + Intergenic
1158578891 18:58664049-58664071 TACAAAAATGGCATTGTGATAGG - Intergenic
1162554088 19:11375661-11375683 TAGAAGTAAGGCAATGAGGTAGG - Exonic
1163823689 19:19511026-19511048 AACAAAAAGGGCAATGTGGTGGG + Intergenic
1163939883 19:20481802-20481824 AACAATATTGGAAAGGAGGTGGG + Intergenic
1164507817 19:28874049-28874071 AACGGTAATGGCAATGAGGAGGG + Intergenic
1165848912 19:38837557-38837579 TGCAATTAGGGCAAGGAGGTGGG + Intronic
1166901995 19:46071722-46071744 TTCAAAAATGGTAAGGAGGTTGG + Intronic
1168049854 19:53821331-53821353 TAAAATAATCACAATGAGCTGGG - Intronic
1168592465 19:57648756-57648778 TACAAAACTGCCAATGAGGTAGG - Intergenic
925094629 2:1186151-1186173 TACACTTATAGCAAAGAGGTTGG - Intronic
925583063 2:5433741-5433763 TACAGTAATAGTAATGATGTAGG + Intergenic
926081364 2:9989033-9989055 TACAATAATGGCTAGGAGATTGG + Intronic
926348013 2:11967166-11967188 TACAATAATGGCATTGTTTTTGG - Intergenic
927326062 2:21806697-21806719 AACAATAATGGCACTCAGTTTGG + Intergenic
928537366 2:32253583-32253605 TAGAATAATGGCAATGGCCTAGG + Intronic
930192766 2:48477415-48477437 TACAAAAATTAAAATGAGGTTGG - Intronic
930273987 2:49290165-49290187 TACAATAATAGAGATGAGTTTGG - Intergenic
930949719 2:57125974-57125996 CACAATATTGGCTAGGAGGTGGG - Intergenic
933247700 2:79994407-79994429 TACAAGAATGTCTATGAGCTGGG - Intronic
933367372 2:81370621-81370643 TACAATCATGAGAATGAGGATGG - Intergenic
936750996 2:115641424-115641446 GACAAAGATGGAAATGAGGTGGG - Intronic
936864361 2:117059576-117059598 TCCAATAATCGTATTGAGGTAGG - Intergenic
938312841 2:130304833-130304855 TACAATAATGATGATGATGTTGG + Intergenic
938609587 2:132933764-132933786 TACAATCATCATAATGAGGTTGG - Intronic
939126107 2:138179481-138179503 CACAATAATTGCTATGAGGAAGG - Intergenic
940263804 2:151815386-151815408 TAGAATAATGGCGATGGGGAAGG - Intronic
943064064 2:183069020-183069042 GACAATCATGGGAAGGAGGTTGG + Intergenic
943523308 2:188983371-188983393 CACATAAATGGAAATGAGGTGGG + Intronic
945344201 2:208693587-208693609 TAGAATAATAGCAATGTGGTGGG - Intronic
1168926221 20:1581687-1581709 TATAGTAATGGCAATGAGGATGG + Intronic
1168930089 20:1614741-1614763 AATAGTAATGGCAATGAGGATGG + Intronic
1168934489 20:1651604-1651626 AACACTAATGGCAATGAGGAGGG + Intronic
1168937591 20:1679727-1679749 AACACTAATGGCAATGAGAATGG + Intergenic
1170254962 20:14331428-14331450 TACAATAGTGGTAATAATGTGGG + Intronic
1170970376 20:21110402-21110424 TGAAATAATGGCAATGACCTTGG + Intergenic
1171075851 20:22122420-22122442 TACAATGATAGCTATTAGGTTGG - Intergenic
1172291686 20:33781423-33781445 TATAATAAGGGCAAGGAGGTGGG + Intronic
1172780293 20:37432782-37432804 AACAATACTGGCCATGAGGATGG - Intergenic
1177026500 21:15927040-15927062 TACAATCATGGCATGGAGGAAGG - Intergenic
1177753871 21:25321257-25321279 TACAAAAAGGGCAATGTAGTTGG + Intergenic
1177831867 21:26148210-26148232 AACAATTATTTCAATGAGGTTGG + Intronic
1179681263 21:43022733-43022755 TATAATAATGGAAAGCAGGTCGG + Intronic
1180905357 22:19406789-19406811 TAAAGTAATGGCAAAGAGGCTGG + Intronic
1182045893 22:27273922-27273944 TACAATATTGGCGGTGGGGTGGG - Intergenic
1184175458 22:42786359-42786381 TACAAAAAGGGCTAGGAGGTGGG + Intergenic
951323528 3:21275794-21275816 TACAATGTTGGGAATGATGTAGG - Intergenic
951844141 3:27067318-27067340 TACAGCACTGGCAATGAGTTGGG - Intergenic
955423985 3:58768536-58768558 TAGGATAATGGCAATGGGTTTGG - Intronic
955966057 3:64390345-64390367 CACAATAATGGCACTGTTGTGGG - Intronic
958614363 3:96472349-96472371 TTCAATAAAGGAAATGTGGTAGG - Intergenic
959005749 3:101017924-101017946 CAAAATATGGGCAATGAGGTTGG + Intergenic
960718898 3:120605698-120605720 AACAATAATGGCCATTAGGATGG - Intergenic
960767403 3:121150242-121150264 TACCATAAAGGCAAAGAAGTAGG - Intronic
963271845 3:143292673-143292695 TAGCATTATGGAAATGAGGTTGG - Intronic
964066887 3:152591087-152591109 TACAAATATGGAAACGAGGTGGG + Intergenic
965281636 3:166762652-166762674 CACAATAATAGCAAAGACGTGGG - Intergenic
965457911 3:168927155-168927177 TACATTCATGACAATGAAGTAGG + Intergenic
967551819 3:190804338-190804360 TACAATAAGGTACATGAGGTGGG - Intergenic
969847019 4:9927311-9927333 TACAACAATAGAAATGGGGTTGG - Intronic
969855168 4:9993357-9993379 TCAAATAAAGCCAATGAGGTTGG + Intronic
972930647 4:44067986-44068008 TACAATAAGGTCATTGAAGTGGG + Intergenic
974058300 4:57006599-57006621 CACAAAAATGTCAAAGAGGTGGG - Intronic
974471806 4:62328833-62328855 TAAAACAATGGCAATGAAGATGG + Intergenic
976480505 4:85538418-85538440 TAATATAATGGCAATTTGGTGGG + Intronic
976679555 4:87740074-87740096 TAGAATACTGGCAAGGATGTTGG - Intergenic
977569843 4:98617706-98617728 TACAATAACAACAGTGAGGTGGG - Intronic
978096096 4:104780318-104780340 TACAAAAATGCCAATGGGGTGGG + Intergenic
978149543 4:105416337-105416359 TATAATAAGGGCAAAGAGATAGG - Intronic
979540222 4:121871826-121871848 TGCAATAATGGCCATGAGGCAGG - Intergenic
979562572 4:122116953-122116975 TGCAATGAGGGCAAAGAGGTAGG + Intergenic
980117979 4:128698927-128698949 TACAATATTGGCAATGTTTTAGG - Intergenic
981179241 4:141719206-141719228 TACAATAATGGTATGGAGGAAGG - Intronic
982826330 4:160008155-160008177 TACCAAAATGGCATTAAGGTAGG + Intergenic
984491086 4:180435796-180435818 TACAATAAAGGGATTGAAGTGGG + Intergenic
986854925 5:11857376-11857398 AACAAAAATGACAATGAGGCTGG + Intronic
988287880 5:29244762-29244784 TCCAATAATGTCAATAAGATTGG - Intergenic
989125743 5:38050895-38050917 GCCAATAATGGGAATGAGCTTGG + Intergenic
989383462 5:40831799-40831821 TAGACTAAAGGCAATGATGTGGG - Exonic
989686684 5:44096872-44096894 AAAAAAAATGGCAATGAGGAGGG - Intergenic
990126885 5:52529969-52529991 TGAAATAAAGGCATTGAGGTAGG + Intergenic
990963292 5:61417188-61417210 TAGACTAATGGAAATTAGGTTGG + Intronic
995207828 5:109502937-109502959 TATTATTATGGCTATGAGGTAGG + Intergenic
995244777 5:109923121-109923143 TACCATAAGGAAAATGAGGTGGG - Intergenic
996531909 5:124535430-124535452 TACTAAAATGGCATGGAGGTTGG + Intergenic
998920794 5:147065620-147065642 TAAGATAGTGGCAATGGGGTTGG + Intronic
999871079 5:155752096-155752118 TAAGATATTGGCAATGAGATGGG - Intergenic
1000820653 5:165979063-165979085 TAGAATGGTGGCAATGGGGTTGG - Intergenic
1001031664 5:168267684-168267706 TAAAATAATAAAAATGAGGTTGG - Intergenic
1005687046 6:28263390-28263412 TACAATATTGGTGATGATGTTGG - Intergenic
1007152554 6:39708455-39708477 TACAATAAGGCCAATGAGGTTGG - Intronic
1011881068 6:92027569-92027591 TACAATAAAGGGAATTTGGTTGG - Intergenic
1012257577 6:97051314-97051336 CCCAATACTGGCAATGGGGTAGG - Intronic
1012351135 6:98252101-98252123 TAAAATTCTGGCAATGGGGTGGG - Intergenic
1013506284 6:110803667-110803689 TACAATAACTACACTGAGGTTGG + Intronic
1017168239 6:151430411-151430433 TACAATAATGGCTATTTGTTTGG - Intronic
1017225021 6:152010955-152010977 AACAATAATGAGAAGGAGGTAGG - Intronic
1018333392 6:162758003-162758025 TACTTTAATGGCAATGCTGTAGG + Intronic
1019824257 7:3270425-3270447 GATAATGATGGCAATGATGTTGG + Intergenic
1019824270 7:3270572-3270594 GATAATGATGGCAATGATGTTGG + Intergenic
1020431123 7:8117150-8117172 TACAATCATGGCAAAGATGAAGG - Intronic
1026602941 7:71791711-71791733 TAAAAAAATGGCATTGAGGCCGG + Intronic
1027509281 7:79059050-79059072 TAAAATAATGGGTATTAGGTTGG + Intronic
1031620948 7:123932907-123932929 TACAGTTCTGGCAATGAGATTGG - Intronic
1032709803 7:134451653-134451675 TACCAGAATGAGAATGAGGTGGG - Exonic
1032948121 7:136874821-136874843 TACAGTTATGGCAAAGGGGTGGG + Intronic
1032954441 7:136954249-136954271 TAAAATAATGGCATTGTGGAGGG - Intronic
1034658229 7:152746194-152746216 TACAATCATGGCAAAGATGAAGG - Intergenic
1035052864 7:156012976-156012998 AACAATAATGTAAAGGAGGTGGG - Intergenic
1036957662 8:13206750-13206772 TACAATATTTGAAATGAGGTAGG + Intronic
1037113429 8:15194509-15194531 TAAACTAAGGGCACTGAGGTGGG + Intronic
1038993012 8:32890097-32890119 CACAATGAGAGCAATGAGGTTGG - Intergenic
1040058625 8:43084790-43084812 CACAAGAAAGGCAATTAGGTAGG - Exonic
1041562687 8:59237977-59237999 TACTATAATGGCAATGATGAGGG + Intergenic
1041785660 8:61630313-61630335 TTGAAAAATGGCAAGGAGGTAGG + Intronic
1042053422 8:64735726-64735748 TACAATTCTGGCAATGAGAATGG + Intronic
1042433334 8:68734600-68734622 TACAATAATGGCAATGAGGTGGG - Intronic
1043750670 8:83929663-83929685 TACAAGAATCGCAAATAGGTGGG - Intergenic
1043817115 8:84814786-84814808 TAAAATAATGTCATTGAGGGGGG + Intronic
1043957948 8:86384145-86384167 TAAAATAATGTCATTGGGGTAGG - Intronic
1044376816 8:91484358-91484380 TACACTGGTGTCAATGAGGTTGG + Intergenic
1046085677 8:109431949-109431971 TCCAATATTGGCAAGGATGTAGG - Intronic
1046567514 8:115919895-115919917 TAAACTAAAGGAAATGAGGTGGG - Intergenic
1046848034 8:118940522-118940544 TATAACAATTGCAGTGAGGTAGG - Intronic
1047551969 8:125883913-125883935 GACAATAATTGCATTAAGGTGGG + Intergenic
1047629371 8:126690323-126690345 GACAATAATGATAATGAGGATGG + Intergenic
1048561194 8:135539282-135539304 CACAATAATGGTAATGTGCTTGG - Intronic
1049904631 9:204331-204353 TGCAAAAATGGCAATTAAGTAGG - Intergenic
1050251227 9:3747015-3747037 TACAATAATGGGAATGAGGGTGG + Intergenic
1055176954 9:73331242-73331264 TACAATAATAGTATTGAAGTGGG + Intergenic
1055653429 9:78430604-78430626 TACAATAATGGCTAGGTAGTTGG + Intergenic
1055655654 9:78448122-78448144 TACAATAATTGGAATAAGGAAGG - Intergenic
1058133277 9:101277592-101277614 TATCATAATGGCAAAGATGTTGG + Intronic
1059291404 9:113227548-113227570 TACAAGAATGCAAATGAGGCTGG - Intronic
1059649064 9:116297795-116297817 AACAATGATGATAATGAGGTTGG - Intronic
1059677331 9:116551730-116551752 TAGAATGATGGCAGTGAGGATGG - Intronic
1059808589 9:117831116-117831138 CACAATAATAGCAATCAGGATGG - Intergenic
1059943981 9:119387274-119387296 TGCAAAAATGCCACTGAGGTTGG - Intergenic
1060440496 9:123634180-123634202 TAAAATCTTGGCATTGAGGTTGG - Intronic
1061350657 9:130062116-130062138 TAAAATAATAGCACTGAGGCTGG + Intronic
1186029554 X:5353146-5353168 TAAAACAATGGAAATGTGGTGGG + Intergenic
1187344969 X:18455025-18455047 CAAAATAGTGGCAATGAGCTAGG - Intronic
1188217952 X:27502022-27502044 TTCAAAAATGGCAATATGGTTGG + Intergenic
1189928986 X:45987844-45987866 AAAAATAATGGCATTGTGGTAGG + Intergenic
1195263622 X:103158936-103158958 TACAATAATGGGCAGAAGGTGGG - Intergenic
1195888463 X:109667135-109667157 TAGAATAATGGCATTGATTTTGG + Intronic
1197176761 X:123494373-123494395 TAAAATAATGGCTATCAAGTAGG - Intergenic
1198802352 X:140460631-140460653 GCCAGTAATGGCAATGAGGTTGG - Intergenic
1199786562 X:151111773-151111795 TACAGTAATGGCAGTGCAGTGGG + Intergenic
1202345315 Y:23917126-23917148 TAAAATAATGGCTAATAGGTAGG + Intergenic
1202525455 Y:25752963-25752985 TAAAATAATGGCTAATAGGTAGG - Intergenic