ID: 1042437490

View in Genome Browser
Species Human (GRCh38)
Location 8:68784185-68784207
Sequence CTTTAAACACAGGGAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042437490_1042437494 -5 Left 1042437490 8:68784185-68784207 CCAAGCTTTCCCTGTGTTTAAAG 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1042437494 8:68784203-68784225 TAAAGACCGCAATGGCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042437490 Original CRISPR CTTTAAACACAGGGAAAGCT TGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901816350 1:11795628-11795650 CTGTAAAAAGTGGGAAAGCTGGG - Intronic
902891007 1:19443702-19443724 CTTTACAAACAAGGAAAGCAAGG + Intronic
907253806 1:53162409-53162431 CTTTAAACATATGCAAAGGTGGG + Intergenic
907622636 1:55996963-55996985 CTCTAAGCACAGGAAAGGCTGGG - Intergenic
908128965 1:61055523-61055545 ATGTAAACACAGGGAAAGCAAGG - Intronic
908730772 1:67224339-67224361 CTTTAAGCACTGGAAAAGTTTGG - Intronic
909973120 1:82014640-82014662 CTCTAGACACAGGGAAAGAAAGG - Intergenic
910540653 1:88352470-88352492 ATTTAGACACAGGGAGAGCTTGG - Intergenic
910760598 1:90727670-90727692 CTTTTAAAAGGGGGAAAGCTGGG + Intergenic
911116726 1:94253300-94253322 CTGTAAGCCCGGGGAAAGCTGGG - Intronic
911949600 1:104155357-104155379 CTTTTAAAAAAGGGAAATCTTGG + Intergenic
915468604 1:156112835-156112857 CCTCAAACACAAGGAAAGCAGGG - Intronic
916318208 1:163473809-163473831 CTTTAGAAACAAGCAAAGCTGGG + Intergenic
917193423 1:172442747-172442769 CTTTGAAAACAAGGAAAGGTTGG - Exonic
917355038 1:174118613-174118635 CTTTAAATAGAAGAAAAGCTGGG - Intergenic
923253779 1:232200859-232200881 CCTTGAATAAAGGGAAAGCTGGG - Intergenic
924235834 1:241998951-241998973 CTTCAAGCAGAGGAAAAGCTTGG - Exonic
1063590759 10:7393674-7393696 ATCTAACCACAAGGAAAGCTGGG - Intronic
1065127323 10:22586260-22586282 CTTTGCACAGAGTGAAAGCTAGG + Intronic
1066130613 10:32389728-32389750 CTTTAAATACAGGGAAAATCAGG + Intergenic
1066320141 10:34294905-34294927 TTTAACACACAGAGAAAGCTGGG + Intronic
1067823071 10:49547977-49547999 TTTTAAATATAGGTAAAGCTTGG + Intergenic
1068749449 10:60574606-60574628 TTCAAAACACAGGGAAATCTGGG + Intronic
1068828122 10:61462564-61462586 CTTTAGCCACAGTGAAAGCTGGG - Intergenic
1071996622 10:91155548-91155570 CTTGAAACACAGAAATAGCTGGG + Intergenic
1073273322 10:102286290-102286312 CTTTGAAAACAGGGAATGCGAGG - Intronic
1074192306 10:111148620-111148642 CTTTCCACTCAGGGAAGGCTTGG - Intergenic
1074192464 10:111149752-111149774 CTTTTCACCCAGGGAAGGCTTGG - Intergenic
1075355043 10:121764244-121764266 ATTTAACAACAGGGGAAGCTGGG + Intronic
1076310924 10:129507026-129507048 CTTTAGACACAGGGAAACTGAGG - Intronic
1077106614 11:845027-845049 CTTTACAGACAGGGAAACGTGGG - Intronic
1077362559 11:2147170-2147192 CTAAAAACCCAAGGAAAGCTGGG - Intronic
1078039086 11:7840826-7840848 GTTTAAAAGCAGGCAAAGCTAGG - Intergenic
1078315310 11:10289324-10289346 CTTAGAACACAGGGAGAACTGGG + Intronic
1078555217 11:12319789-12319811 CTTTAACTGCAAGGAAAGCTGGG - Exonic
1079055226 11:17200313-17200335 ATTTAAACATAGGGGAAACTAGG + Intronic
1079486736 11:20942751-20942773 CTTTGACTTCAGGGAAAGCTGGG + Intronic
1083287139 11:61667336-61667358 CTTTACAGACAGGGAAGCCTTGG + Intergenic
1086454783 11:86950676-86950698 CTATAAACACTGGAAACGCTGGG - Exonic
1089062498 11:115637260-115637282 CTCTAAACCCAGGGACAGCTGGG - Intergenic
1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG + Intronic
1091508911 12:1101590-1101612 CTTTAATCACAAGAAAGGCTGGG + Intronic
1093357934 12:18192439-18192461 GTTCAGACACAGGGAAAGTTAGG - Intronic
1094484538 12:30914195-30914217 CTTTAAGCTCAGTGAGAGCTGGG + Intergenic
1095276123 12:40284758-40284780 AAGTTAACACAGGGAAAGCTGGG - Intronic
1095757877 12:45791022-45791044 CTTTAAATAAATGGAAAGCAAGG - Intronic
1096053665 12:48632854-48632876 ATTTACAGACAGGGAAAGATTGG + Intergenic
1096228979 12:49887127-49887149 CTGTAGACAGAGGCAAAGCTGGG - Intronic
1096494411 12:52031323-52031345 TTTTAAACTGAGGGAAGGCTGGG - Intronic
1098621598 12:72607839-72607861 CTTTAAAAAGAGGAAAGGCTTGG - Intronic
1099590548 12:84582535-84582557 CATTAACAACAGGGAAAACTGGG + Intergenic
1099726513 12:86436084-86436106 CTTTAAACCCATGGGAAGCAAGG - Intronic
1100233659 12:92635555-92635577 CATTAATCACAGGGAAAACTGGG + Intergenic
1100243842 12:92736738-92736760 CCTCAAACACACTGAAAGCTGGG + Intronic
1102304886 12:111797232-111797254 CTGTAAAAAGAAGGAAAGCTTGG - Intronic
1102693217 12:114778021-114778043 CTTTAAAGCCAGAGAGAGCTAGG - Intergenic
1103894264 12:124262631-124262653 CTTTAGAGACAGGGAAACCAAGG - Intronic
1104173801 12:126309276-126309298 TTTCAGACAAAGGGAAAGCTCGG - Intergenic
1106259190 13:28050498-28050520 GTTTAAAGACAGGGAAAGAAAGG + Intronic
1106356888 13:28991770-28991792 CTTTAAACAAAGGGGAAGGAGGG - Intronic
1107804162 13:44138671-44138693 TTTTAAAAAGAGGGAAAGATTGG - Intergenic
1109199331 13:59413001-59413023 CTTTAAACACAAGGAAAAATGGG - Intergenic
1110106552 13:71684279-71684301 CTTTAAGCAAATGGAAAGCAAGG - Intronic
1112235225 13:97629977-97629999 CTTTATACCCAGGCAAAGTTAGG + Intergenic
1112406196 13:99122992-99123014 ATTACAACACAGGGAAAGCCTGG + Intergenic
1113980925 13:114274855-114274877 CTTTAAAAACAGAAAAAGTTTGG - Intergenic
1114494193 14:23121330-23121352 CTTTATAAACAGGGAAAACAAGG + Intergenic
1114677909 14:24457607-24457629 CCCTAAGCCCAGGGAAAGCTAGG + Intergenic
1114855949 14:26443847-26443869 CATTAAATACAGGGCAAGCATGG - Intronic
1114965740 14:27957094-27957116 CTTTATACAGACGGAAATCTGGG - Intergenic
1115519628 14:34220592-34220614 CTTTAGAAACTGGGAAGGCTGGG - Intronic
1115884665 14:37958132-37958154 GTTTGAACACTGTGAAAGCTGGG + Intronic
1116949034 14:50861964-50861986 CTAGAAACACAGGGAAGACTTGG - Intronic
1117965493 14:61203246-61203268 CTTGGAAGACAGGGACAGCTGGG - Intronic
1119275945 14:73356345-73356367 CTTTAAACACACTTAAAGCCAGG + Intronic
1119372598 14:74160158-74160180 CTTTATACAAAGGAAAAGTTTGG + Intronic
1119394123 14:74313295-74313317 TTTTATATACAGGGAAACCTAGG - Intronic
1121226984 14:92328349-92328371 ATCTCAACACAGGGAAAGCTAGG + Intronic
1121526486 14:94622795-94622817 CATTTGACACATGGAAAGCTGGG - Intronic
1122171526 14:99879827-99879849 CTTTGAATTCAGGGTAAGCTTGG + Intronic
1122361377 14:101168603-101168625 CTTGAAACAAATGGAAAGATAGG - Intergenic
1122398431 14:101451607-101451629 CTTCAAACCCAGGGGATGCTGGG + Intergenic
1122883008 14:104698494-104698516 TTATAGACACAGGGAAGGCTCGG + Intronic
1122897087 14:104764183-104764205 ATTTAAAGACAGGGTCAGCTGGG - Intronic
1126384576 15:48080834-48080856 CTTTAAGCAGAGGGTAAGCATGG + Intergenic
1128642500 15:69349935-69349957 CTTGAAACTAAGGGAAGGCTGGG - Intronic
1128780196 15:70354153-70354175 CATTAAACACAAACAAAGCTGGG - Intergenic
1130983111 15:88826476-88826498 CTGGAGACACAGGGAAAGCCAGG + Intronic
1135600673 16:23780859-23780881 GTTTAAGCACAAGGAAAGCTTGG - Intergenic
1136383597 16:29909082-29909104 CTTTTCACACAGTGGAAGCTAGG - Intronic
1136475496 16:30510645-30510667 CTTTAGAATCAGGCAAAGCTGGG + Intronic
1138417216 16:56878267-56878289 CTCTAACAACAGGGAGAGCTGGG + Intronic
1138969489 16:62127684-62127706 ATTTAAACACAAGCAAACCTAGG - Intergenic
1139494563 16:67306924-67306946 CTTTGAGCACATGGGAAGCTAGG + Intronic
1139751630 16:69112441-69112463 CTTCCAACATAGAGAAAGCTGGG + Intronic
1140668412 16:77249551-77249573 CTTTAAAAAAAGGGAACACTTGG + Intronic
1141445426 16:84054977-84054999 CTCTAAACACAAGGGAAGATGGG + Intronic
1144073108 17:11692234-11692256 GTTTACACACAGGGAAACCAAGG - Intronic
1144782986 17:17817137-17817159 CTATGGACAGAGGGAAAGCTGGG + Intronic
1144789596 17:17850035-17850057 CTTTAACCACAGGGTCAGCCTGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147269475 17:39257817-39257839 CTTTAAATAGAGGGAAAGGATGG + Intergenic
1147395810 17:40141764-40141786 CTTTAGACCTAGGGAAAACTTGG + Intronic
1147754902 17:42761548-42761570 CTTCCCACCCAGGGAAAGCTGGG + Intronic
1148669499 17:49400004-49400026 TTTTATATACAAGGAAAGCTTGG + Intronic
1149383902 17:56123098-56123120 CTTTATACACAGGGAAACTGAGG + Intronic
1150626328 17:66843589-66843611 GTTTAAACACAGGGGAAGATGGG - Intronic
1152060989 17:78075008-78075030 CTTCAAACACAGGGAAGCCAGGG - Intronic
1153496100 18:5701778-5701800 CTTCAAAGACAGGCAAAGCAGGG - Intergenic
1154136209 18:11781130-11781152 CTTTAAATATAGGGAAAATTTGG + Intronic
1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG + Intronic
1156507603 18:37608256-37608278 CTGTAAACACAGGCAGAGCCAGG + Intergenic
1156610616 18:38719726-38719748 CTTTAAAACCAGTGTAAGCTGGG + Intergenic
1156917643 18:42480450-42480472 CTTTAAACATAACAAAAGCTGGG - Intergenic
1158110838 18:53940035-53940057 CTCTAACCACAGGGGAGGCTCGG - Intergenic
1159350896 18:67271114-67271136 CTTTTAACATAAGGAAAGGTGGG - Intergenic
1159820631 18:73138232-73138254 ATATAAACACAGGCAAAGTTAGG + Intergenic
1167848195 19:52181742-52181764 CTTTAAAAAAATGGAAATCTAGG - Intergenic
925660736 2:6199513-6199535 CTTTAAAAACACAGAAAACTGGG - Intergenic
925801287 2:7604532-7604554 TTTTAAACACAGAGAAAGAAGGG + Intergenic
926111624 2:10187651-10187673 TTTTACACACAAGGAAGGCTGGG - Intronic
927089236 2:19697974-19697996 GTTTAAAAAGAGGGAAAACTAGG + Intergenic
927316702 2:21691412-21691434 CTTCAGACACAGGAGAAGCTAGG + Intergenic
927939872 2:27096807-27096829 CTTGAAACACAGGTAAGGCAGGG - Intronic
928607402 2:32955251-32955273 CTCTAAACATTGGGATAGCTCGG + Intronic
931017825 2:58006134-58006156 CTTTATACAGAGAGAAATCTGGG + Intronic
931218733 2:60270069-60270091 ATGTGAACACTGGGAAAGCTCGG - Intergenic
933760833 2:85670829-85670851 CACTAACCCCAGGGAAAGCTGGG + Intergenic
934633108 2:95952141-95952163 TTTTAAACAAAGGGAAAGGAGGG + Intronic
934800395 2:97151128-97151150 TTTTAAACAAAGGGAAAGGAGGG - Intronic
935236233 2:101140541-101140563 ATCTAAACTCAGGGAGAGCTTGG - Intronic
935694242 2:105757307-105757329 ATTTTAACACAGCGAAAGTTGGG - Intronic
936017360 2:108969951-108969973 CTTTAAACACAGTTAAAAGTGGG + Intronic
938783284 2:134604235-134604257 TTTACAATACAGGGAAAGCTGGG + Intronic
939442802 2:142271752-142271774 CTCTAACTAGAGGGAAAGCTGGG - Intergenic
942259653 2:174146263-174146285 TTTTAAACAAAGGGAAGGCAGGG + Intronic
942894221 2:181032147-181032169 CTCTAAACCCAAGAAAAGCTAGG - Intronic
944294154 2:198043174-198043196 TTTTAAAAACAGTGAAAACTGGG + Intronic
948085220 2:235241706-235241728 CCTTAAAAACAGGGAAAATTTGG - Intergenic
1169009382 20:2237609-2237631 CGCTCAAGACAGGGAAAGCTGGG - Intergenic
1169025885 20:2370930-2370952 CTTTAAACACAGGAAAGACTGGG + Intergenic
1169430986 20:5536074-5536096 TTTTAAACACATGCAAAGGTAGG + Intergenic
1169751441 20:8998697-8998719 CTTAAAAGACAGGGTCAGCTGGG + Intergenic
1170235756 20:14103250-14103272 CTTTAAAAATAGGGATAGCAGGG - Intronic
1174669112 20:52289651-52289673 CTTAAAACACACGGATTGCTTGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1176079407 20:63264506-63264528 CTGGAGACACAGGGACAGCTAGG - Intronic
1178199760 21:30390509-30390531 CTTTAAACAGAAGGAAAGGAGGG + Intronic
1184259551 22:43306812-43306834 CTCTAGACACAGGGAGAGCATGG - Intronic
1184683248 22:46084344-46084366 TTCTGAACACATGGAAAGCTGGG + Intronic
949837595 3:8286167-8286189 CCTTAAACAATGGGAAAGTTAGG - Intergenic
951934830 3:28010906-28010928 ATTTAAACAAAGGGAAAATTTGG + Intergenic
953217353 3:40931598-40931620 CTTCAAACACCTGGAAAGCCTGG + Intergenic
956667892 3:71659097-71659119 TTATATAGACAGGGAAAGCTAGG + Intergenic
956722046 3:72126578-72126600 CTTTAAAAATTGGGGAAGCTTGG + Intergenic
958890828 3:99780928-99780950 CTTTGAACAAAGGCAAAGCTCGG - Intronic
959144549 3:102529152-102529174 CTATAAATATAAGGAAAGCTGGG - Intergenic
960725006 3:120661220-120661242 CATTAAAAGGAGGGAAAGCTTGG - Intronic
961805506 3:129486627-129486649 TTTCAAACAAAGGGAAAGGTGGG + Intronic
962705456 3:138039056-138039078 CTTTGATAACAGGGAAAGCTTGG - Intergenic
963800021 3:149666878-149666900 CTTTAAAGAGAGGGAAAGAGAGG + Intronic
963808273 3:149748409-149748431 CTGTAAACACTGGGATAGCAGGG - Intronic
965935917 3:174111409-174111431 CTTTAAAAACTGGGAAAGGAGGG - Intronic
968530791 4:1090361-1090383 CTTTAAAGACAAGGGAACCTGGG - Intronic
968570789 4:1339492-1339514 CTGAAAACACAGGGAAATCACGG - Exonic
969038861 4:4277892-4277914 CTACAAACACAGGGTATGCTGGG + Intronic
969202753 4:5618706-5618728 CTCTTAACACAGAGAAAGCCTGG + Intronic
969459068 4:7318194-7318216 CTTTACAGACAGGGAAACCAAGG + Intronic
969990488 4:11257378-11257400 CTTTGCAGTCAGGGAAAGCTGGG + Intergenic
971088552 4:23310913-23310935 CTTTAAATACATGGAAAGTATGG - Intergenic
971296485 4:25398059-25398081 TTTAAAACAAAGAGAAAGCTTGG - Intronic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972658671 4:41092414-41092436 CTTTAAACTAAGGGCAAACTTGG - Intronic
973590678 4:52437478-52437500 CTGTAAACAGAGGGAGACCTTGG - Intergenic
974431335 4:61800393-61800415 CTTTGAACACTGAGAAAACTTGG + Intronic
975576507 4:75868420-75868442 CTTTTAACACGGGAAAAGATAGG - Intronic
976020738 4:80622103-80622125 CTATAAGCACAGGGAAATATTGG + Intronic
977589455 4:98810206-98810228 CTTTAAAAATATGGAAAGCAAGG + Intergenic
979357919 4:119727625-119727647 CTACAAACACAGGGACACCTAGG - Intergenic
986652721 5:9980207-9980229 CCTGAATCACAGGGAAAGCTGGG + Intergenic
987259681 5:16190528-16190550 CCTGAATAACAGGGAAAGCTAGG + Intergenic
988726810 5:33934615-33934637 GTTGAAACACAAGAAAAGCTGGG - Intergenic
989458132 5:41665835-41665857 CTATAAACACTGTGAAAGGTAGG - Intergenic
990059779 5:51633168-51633190 CTTTAAAAACAGAGAAAGACTGG - Intergenic
990911084 5:60852986-60853008 TTTCAAACAAATGGAAAGCTTGG - Intergenic
993141414 5:84038589-84038611 CTTTCAAAAGAAGGAAAGCTGGG + Intronic
994786357 5:104169374-104169396 CTTTCATCACAGGGAAATTTTGG - Intergenic
996104351 5:119481448-119481470 CTTTAAATACAGGCATATCTTGG + Intronic
998079264 5:139261148-139261170 CTGTGAAGACAGGGAATGCTTGG - Intronic
1000140128 5:158395162-158395184 TGTTAACCACAGGGAAATCTGGG + Intergenic
1000640394 5:163695690-163695712 CTTCAAATACAGAGAAAGCCAGG - Intergenic
1001402609 5:171454631-171454653 CTTTGAGCAGAGGGCAAGCTTGG - Intronic
1001609174 5:172986337-172986359 CTTAAAACACAAGCAAGGCTGGG + Intronic
1002017856 5:176340060-176340082 CCCTAAACAAAAGGAAAGCTTGG - Intronic
1003113054 6:3264961-3264983 ATTTATACAGACGGAAAGCTGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006095936 6:31656801-31656823 CTTGAAACCCAAGGAGAGCTGGG + Intronic
1006386688 6:33734915-33734937 CTGTAAACACAGGGCAAAATGGG - Intronic
1010775032 6:79875688-79875710 TTTTAAACATAGGCAAAGGTAGG + Intergenic
1010898600 6:81398087-81398109 CTGTAAATACAGGCAAATCTTGG - Intergenic
1011154495 6:84314955-84314977 CTTTGAAAACAGAGAATGCTAGG - Intergenic
1012527019 6:100190043-100190065 CTTCAAATACAAGGAAAGTTTGG - Intergenic
1013082769 6:106826893-106826915 CTTTAAAGAAAGGTAAGGCTGGG + Intergenic
1013583085 6:111554810-111554832 TTTTATACACAAGGAAAGCAGGG - Intergenic
1015027945 6:128559574-128559596 CTTTAAAAACAGGCACTGCTGGG - Intergenic
1015150322 6:130030197-130030219 CTTTGCACACAGTGAATGCTTGG - Intronic
1016186355 6:141202349-141202371 CTTGATGCACAGGGAAATCTGGG + Intergenic
1016759921 6:147725682-147725704 TTTTAAAGACAGGTAAGGCTGGG - Intronic
1017666000 6:156720570-156720592 TTTTAGTGACAGGGAAAGCTAGG - Intergenic
1017971294 6:159314795-159314817 CTCTGAACACAGGATAAGCTGGG + Intergenic
1018016108 6:159713761-159713783 CTTTAAAGACAGAGAAACCATGG - Intronic
1019940258 7:4283820-4283842 CCTTGATGACAGGGAAAGCTGGG - Intergenic
1023365378 7:39458396-39458418 ATGTAAACACTAGGAAAGCTGGG + Intronic
1023901525 7:44484669-44484691 CTCTAAACACAGATAAAGTTAGG + Intronic
1024357199 7:48426388-48426410 CCCTAACCACAGGGAAAGATGGG - Intronic
1024809873 7:53196478-53196500 CTACAAACACAAGAAAAGCTTGG + Intergenic
1026621533 7:71953881-71953903 CTTCATAGACAGGGAGAGCTAGG + Intronic
1026967179 7:74447755-74447777 CTGAAAAGACAGGGAAAGCCAGG + Intergenic
1028295982 7:89132100-89132122 CTTTCAGCACATTGAAAGCTAGG - Intronic
1028724556 7:94072547-94072569 CTTGAAACACACAGAAAACTGGG - Intergenic
1028814483 7:95129020-95129042 TTTTATATACAGTGAAAGCTAGG + Intronic
1029284288 7:99455403-99455425 TTGAAAACACAGGGACAGCTGGG + Intronic
1031342538 7:120621387-120621409 CTTTAAACACATTGAAGGATGGG + Intronic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1031447969 7:121878070-121878092 CTTTAAACACAGAGAAAAATTGG - Intronic
1031651589 7:124297827-124297849 CATTAACCAGAGGAAAAGCTAGG - Intergenic
1032626886 7:133601069-133601091 ATATAAACAAAGGGGAAGCTGGG - Intronic
1035083469 7:156236584-156236606 CTCTAAAAACAGGGACAGCCTGG + Intergenic
1035944757 8:3949788-3949810 CCTCTAACACATGGAAAGCTGGG + Intronic
1037520530 8:19676330-19676352 CTTGAAATAAATGGAAAGCTGGG + Intronic
1039517146 8:38143727-38143749 CTTTTTCCACAGAGAAAGCTTGG + Exonic
1040894029 8:52347261-52347283 CTGTAAAAGCAGGAAAAGCTTGG + Intronic
1041639075 8:60177490-60177512 CATTAAAGATAGGAAAAGCTAGG + Intergenic
1042437490 8:68784185-68784207 CTTTAAACACAGGGAAAGCTTGG - Intronic
1043728067 8:83637547-83637569 GTTTACACACAGGGAAAGCAAGG - Intergenic
1044280234 8:90346116-90346138 CGTTAATAATAGGGAAAGCTGGG - Intergenic
1044728903 8:95214664-95214686 CTTTAAATCCAGGGACAGCCTGG + Intergenic
1046257329 8:111718614-111718636 GTTTAAACAAAGGGAAATCTAGG + Intergenic
1046740037 8:117818252-117818274 CTTTCAAATCAGGGAAATCTGGG - Intronic
1047900330 8:129414416-129414438 CTTTAAAGTCAGGAAAAGCAGGG - Intergenic
1049068778 8:140340676-140340698 CTTTAAAGTCAGGCAGAGCTGGG - Intronic
1049923464 9:386809-386831 CTTTTAGTAGAGGGAAAGCTGGG + Intronic
1050603315 9:7274379-7274401 TGTTAAACGCAGTGAAAGCTTGG + Intergenic
1050740611 9:8815288-8815310 CTTTAATCACAGGGAATGGTAGG + Intronic
1052596291 9:30562358-30562380 CATTAGAAACAGGGAAAACTGGG + Intergenic
1053590885 9:39513477-39513499 TTTTAATCTCTGGGAAAGCTTGG + Intergenic
1053848733 9:42268834-42268856 TTTTAATCTCTGGGAAAGCTTGG + Intergenic
1054575421 9:66851813-66851835 TTTTAATCTCTGGGAAAGCTTGG - Intergenic
1056182663 9:84100968-84100990 CCTTAAAGACAGGGAAAGCCTGG - Intergenic
1057522984 9:95774925-95774947 AAGTGAACACAGGGAAAGCTGGG + Intergenic
1057746172 9:97753172-97753194 TGTTAACCTCAGGGAAAGCTGGG - Intergenic
1058747532 9:108006766-108006788 CTGTAAACACAGAGAAATCAAGG - Intergenic
1059673602 9:116515206-116515228 AAGAAAACACAGGGAAAGCTAGG - Intronic
1059725947 9:117008177-117008199 CTGGTAATACAGGGAAAGCTTGG + Exonic
1059996582 9:119916053-119916075 CTTCAAGCACAGGGAAAGAGAGG - Intergenic
1061373788 9:130212514-130212536 CTTTACTCACAGGGAAACCGAGG + Intronic
1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG + Intergenic
1187161724 X:16771491-16771513 CTTTAATAAAAGGGAAAGCCAGG + Intergenic
1187314513 X:18180199-18180221 TTTTAAAGTCAGAGAAAGCTGGG + Intronic
1188976614 X:36683267-36683289 CTGCATACACAGGGAAAGGTGGG + Intergenic
1190741586 X:53292292-53292314 CTTGAAACACAGGAAGACCTAGG + Intronic
1194831544 X:98629609-98629631 CTTTACACTAAGAGAAAGCTAGG + Intergenic
1196767364 X:119259615-119259637 CGTTAATCATGGGGAAAGCTGGG + Intergenic
1198401766 X:136275554-136275576 CTCTGAACACAGAGAAAGCAGGG - Intergenic
1201500494 Y:14637232-14637254 CATTAAAGAAAGGGAAAGGTTGG + Intronic