ID: 1042439052

View in Genome Browser
Species Human (GRCh38)
Location 8:68803305-68803327
Sequence TGCAATAAACTCAATGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042439052_1042439054 16 Left 1042439052 8:68803305-68803327 CCTACTACATTGAGTTTATTGCA 0: 1
1: 0
2: 2
3: 10
4: 155
Right 1042439054 8:68803344-68803366 TTAATTTTTGAAAATTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042439052 Original CRISPR TGCAATAAACTCAATGTAGT AGG (reversed) Intronic
900340120 1:2184514-2184536 TGCAAAACACTCAATCTGGTAGG + Intronic
901189420 1:7398592-7398614 TGGAATAAATTCAATGTAAATGG - Intronic
901969522 1:12896113-12896135 TGCAATAAACTCATAGCACTGGG + Intronic
902015650 1:13305667-13305689 TGCAATAAACTCATAGCACTGGG - Intronic
902767763 1:18628632-18628654 TGCAAAAGACTCACAGTAGTGGG - Intergenic
906472930 1:46146128-46146150 TGCAAGTAACAGAATGTAGTTGG - Intronic
908623348 1:66010671-66010693 TGGAAGAAAGTCAATGAAGTGGG - Intronic
909924335 1:81421222-81421244 TGCAATAAACCTAAGGTATTAGG - Intronic
910804504 1:91177142-91177164 TCCCATGGACTCAATGTAGTTGG + Intergenic
912506761 1:110161839-110161861 GGCAATAAGCTCAAGGTGGTGGG - Intronic
913373180 1:118123223-118123245 TGCAATAACTACAATATAGTTGG - Intronic
916811716 1:168311755-168311777 TGCAATGAACCCAATGTTTTCGG - Intronic
917466193 1:175278531-175278553 TGAAATAAACTTAATTTACTTGG + Intergenic
918602272 1:186377437-186377459 TGTAAGAAACTGAATGTAATAGG - Intronic
921650445 1:217671988-217672010 TGCTATAAACTTATTGTTGTTGG - Intronic
922688578 1:227667945-227667967 TTCAATAAACTCAGGGCAGTGGG - Intronic
1063852716 10:10211143-10211165 TGCAATAAGCACAATGTATATGG + Intergenic
1068032699 10:51723165-51723187 TGCAATAAACTCAATTAATCAGG - Intronic
1071112051 10:82171127-82171149 TGCAATTCAATCAATGTATTTGG + Intronic
1074080375 10:110163717-110163739 GGTAATGAAATCAATGTAGTAGG + Intergenic
1080795556 11:35559825-35559847 TGAAATAAAATCCATGTAGCTGG - Intergenic
1081639709 11:44744446-44744468 TGCAAGAAACTCCATGGAGTGGG + Intronic
1082943247 11:58730483-58730505 TGCAGTAAAAGCAAGGTAGTGGG - Intronic
1086052035 11:82603593-82603615 TCCAATAAACTGAATAAAGTGGG - Intergenic
1087718361 11:101634781-101634803 TTCAATAATCTCACTGTACTGGG + Intronic
1089417623 11:118305453-118305475 TGAAATAAACTGAAAGTTGTTGG - Intronic
1092019985 12:5193667-5193689 TGCAATCAACTCACTGGTGTTGG - Intergenic
1095308632 12:40668221-40668243 TGCAATAAATGCACTGAAGTGGG + Intergenic
1097650780 12:62294947-62294969 TGCAGTAAACTGAAGGCAGTTGG - Intronic
1099061238 12:77912033-77912055 TGCCATAAACTCAATGCAGTAGG - Intronic
1103040975 12:117695402-117695424 TGCAATAAAATAAATGTGTTGGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1107159886 13:37213490-37213512 TGTAATAAACTCAAACTAGAAGG + Intergenic
1108097364 13:46917520-46917542 TGCAGCAACCTGAATGTAGTTGG - Intergenic
1109093640 13:58082313-58082335 TACAATGAACTCTATGTAGGGGG + Intergenic
1109631259 13:65049607-65049629 TGCAAAAAATTAAATGTAGATGG - Intergenic
1111590788 13:90346254-90346276 TTCAATAAACTAAGTATAGTAGG - Intergenic
1112463684 13:99624751-99624773 TGAAATAAACAGAATGTAGGTGG - Intronic
1112617567 13:101020879-101020901 TGCAGTAAGCTCAATGAACTTGG + Intergenic
1114698815 14:24655813-24655835 TGAGATAAACTCAATAAAGTAGG + Intergenic
1115667563 14:35569858-35569880 TGCAAATAATTCAATCTAGTTGG - Intronic
1116645097 14:47517633-47517655 TGCAATCAACTCAATGAACTTGG + Intronic
1119818692 14:77594901-77594923 TGCCATCAACTCAGTCTAGTAGG + Intronic
1121973863 14:98384527-98384549 TGGAATAAACTAAGTTTAGTTGG + Intergenic
1122015272 14:98789805-98789827 TGAATTAAACTCAATGGAGATGG - Intergenic
1124959551 15:34384188-34384210 TGAAAAAAACTCAGTGAAGTTGG + Intronic
1124976177 15:34530409-34530431 TGAAAAAAACTCAGTGAAGTTGG + Intronic
1126207467 15:46061400-46061422 TGAAATAATCTCAAAGTATTTGG - Intergenic
1130640562 15:85670029-85670051 TACAATAAACTTAATGTATTAGG - Intronic
1135012991 16:18900713-18900735 TGCACTAAAGCCAATGAAGTAGG + Intronic
1135319912 16:21488285-21488307 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1135372748 16:21919772-21919794 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1135432850 16:22401264-22401286 CACAATAAACTCAATCCAGTGGG - Intronic
1135439034 16:22450929-22450951 TGCACTAAAGCCAATGAAGTAGG - Intergenic
1136330143 16:29569997-29570019 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1136444768 16:30309702-30309724 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1137014504 16:35361597-35361619 TTCAACAAACTCCATGTATTTGG - Intergenic
1138188820 16:54997906-54997928 TCCAATAGACTCACTGTAGTGGG - Intergenic
1138842999 16:60531825-60531847 TGCAATAATGTCAATGTCATAGG - Intergenic
1138920515 16:61522897-61522919 TGACATAAATTCCATGTAGTTGG + Intergenic
1141560965 16:84867539-84867561 TGCAATGATCTCAATGTACAGGG - Intronic
1146132856 17:30293357-30293379 GTTAAGAAACTCAATGTAGTAGG + Intergenic
1146515436 17:33485625-33485647 TCCCCTAAACTCAATGAAGTGGG + Intronic
1147491928 17:40877552-40877574 TGCAATAAAAGCAATGTAAAAGG - Intronic
1150262306 17:63803993-63804015 TGCAATAATTTGAATATAGTAGG + Intronic
1156631286 18:38972471-38972493 TCAAATAAACTAATTGTAGTTGG - Intergenic
1157612292 18:48965018-48965040 TGCAATAAACTCTATGCATGTGG + Intergenic
1159517640 18:69477848-69477870 TTCAATAAACCAAATGTAGGAGG - Intronic
1159521182 18:69527207-69527229 TGAAACAAACTCAGTGAAGTGGG - Intronic
1163948225 19:20560446-20560468 TGCAATAACGTCAATGAAGCTGG + Intronic
1163969881 19:20781837-20781859 TGCAATAACATCAATGAAGCTGG - Intronic
1165844149 19:38807393-38807415 TGCAAAAAACACAAAGTGGTAGG + Intronic
1166786058 19:45367811-45367833 TGCTATAAAATCATTGTACTTGG - Intronic
925815161 2:7740146-7740168 AGCATTAAACTCCCTGTAGTTGG + Intergenic
930401790 2:50899401-50899423 TTGAATAAACACAGTGTAGTGGG - Intronic
931217427 2:60259595-60259617 GGTCATAAAATCAATGTAGTGGG + Intergenic
931275328 2:60739247-60739269 TGCATGAAACGCAATGAAGTGGG - Intergenic
931586016 2:63829297-63829319 GGCAATGAAATCAATTTAGTAGG - Intergenic
933536439 2:83581176-83581198 AGTAATAAACTCAATTTATTTGG - Intergenic
934122989 2:88857953-88857975 TGCAGTAAACTCAATGCTTTAGG + Intergenic
939033625 2:137105365-137105387 TGCTATAAACTCAATAAACTAGG + Intronic
940552781 2:155182887-155182909 TTCAATAAACTGAATTGAGTTGG + Intergenic
941977323 2:171419657-171419679 TGCAATAACCTCACTGAAGGGGG - Intronic
944034832 2:195282017-195282039 TGCTATCATCTCAATGTACTGGG - Intergenic
945508349 2:210669026-210669048 TGAAATAAACTGACTGTATTAGG - Intronic
947308094 2:228769593-228769615 TGCAATAACCTCAATCAAATTGG - Intergenic
1169917312 20:10696556-10696578 TGCAAACCACTCAATGTACTCGG + Intergenic
1176992140 21:15509725-15509747 TGAAATAATCTCAAATTAGTGGG + Intergenic
1179128333 21:38611983-38612005 TAAAATAAACTAAATTTAGTTGG + Intronic
1180501461 22:15933484-15933506 TGCTAAAAACTCAATAAAGTAGG - Intergenic
1182407096 22:30144469-30144491 TGCAATAAAGTCACTGTCTTTGG + Intronic
1183019728 22:35017623-35017645 TGCAAGAAACTCGAACTAGTTGG - Intergenic
1183553061 22:38504747-38504769 TGTAATAGTCTCACTGTAGTAGG - Intronic
1184801994 22:46766881-46766903 TGCATCAAACTCAGTGTTGTTGG + Intronic
952047489 3:29340492-29340514 TTCATTAAACTCAATTTATTTGG - Intronic
954652095 3:52171334-52171356 AGCAAGAAGCTCAATGTGGTTGG - Intergenic
956642850 3:71430992-71431014 TGCAGTAAAATCAAAGTGGTGGG - Intronic
957819960 3:85359502-85359524 TGAAATAAATTCAATCTATTGGG + Intronic
959174364 3:102887119-102887141 TGAAATAAAATCAATGTTTTTGG - Intergenic
959416459 3:106081079-106081101 TGCAAAAATTTCAAAGTAGTTGG + Intergenic
966013783 3:175116042-175116064 TGCAAAAAACTCAATAAACTAGG + Intronic
966956931 3:184891159-184891181 TGATATAAACTCAAAGTCGTCGG - Intronic
970439916 4:16071797-16071819 TCCAAGAAACTGAATGGAGTAGG + Intronic
971240430 4:24883643-24883665 CACAATAACCTCAATGTAGGGGG - Intronic
974582937 4:63830052-63830074 TTCAATAAACTAAATATAGATGG + Intergenic
974902907 4:68022823-68022845 TGCAATGAAATCAATGTAATTGG - Intergenic
975726578 4:77297658-77297680 TGCTAAAAACTCAATAAAGTAGG - Intronic
975729507 4:77323810-77323832 TGCTAAAAACTCAATAAAGTAGG - Intronic
978020024 4:103797206-103797228 TACAATAAAATCAGGGTAGTTGG + Intergenic
978766967 4:112414275-112414297 AGCCAAACACTCAATGTAGTGGG + Intronic
979180388 4:117719296-117719318 TGCAATAAACTCATATTATTGGG + Intergenic
979710832 4:123777457-123777479 TCAAATTAGCTCAATGTAGTTGG - Intergenic
981239153 4:142454244-142454266 AACAATAAACTCGATATAGTAGG - Intronic
982383388 4:154773911-154773933 TGCTAAAAACTCAATGAATTAGG - Intergenic
986590745 5:9366804-9366826 AGCAATAGAATCAATGTGGTAGG + Intronic
989271553 5:39539540-39539562 TGAAAGAAACACAACGTAGTTGG + Intergenic
992560889 5:77951762-77951784 AGCAATTAACTCTATGAAGTTGG + Intergenic
994671995 5:102773208-102773230 TGTAATAAACTAAAAGTACTGGG + Intronic
994860930 5:105193155-105193177 TTCAATATACTAAATTTAGTGGG - Intergenic
995834917 5:116390434-116390456 TGCCATGAACTCAAGGTAGTAGG - Intronic
996446002 5:123551467-123551489 TGTCATAAACTCAATACAGTTGG - Intronic
999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG + Intergenic
1002353336 5:178601573-178601595 TGAAATAAAGTCACTGTATTTGG + Intergenic
1003350166 6:5309082-5309104 TGCTATAAACTCAATGTTTGTGG - Intronic
1003468561 6:6406192-6406214 TGCAATAAACTCAATAAAATTGG - Intergenic
1004543880 6:16578032-16578054 TGTAATAAAATTAATGTAGTGGG - Intronic
1004766592 6:18735234-18735256 TGCAATAAAATAAAAGTAATAGG - Intergenic
1006332813 6:33404486-33404508 TGCAAATAACTTAATCTAGTTGG - Intronic
1007528796 6:42521734-42521756 TGCAAAAAACCAAATGAAGTGGG + Intergenic
1008879565 6:56367335-56367357 GGAAATAAACTGACTGTAGTTGG - Intronic
1011402145 6:86975217-86975239 TGGAATAAACTCAATGGAGTTGG - Intronic
1011470634 6:87704348-87704370 TGTAATTAGCTAAATGTAGTAGG + Intergenic
1012379267 6:98600487-98600509 TCCAAGAAACTGAATGAAGTTGG - Intergenic
1012821996 6:104096634-104096656 TGCAATGAAATTAATGTAGTTGG + Intergenic
1014566533 6:122956202-122956224 GGAAATAAACTCAGTGTTGTTGG + Intergenic
1017448582 6:154531835-154531857 TGCAGTAAACACATTCTAGTGGG - Intergenic
1018157484 6:161000227-161000249 GGTAATAAAATCAATTTAGTAGG - Intronic
1018464234 6:164028673-164028695 TGTAATAAAAACAATGCAGTTGG - Intergenic
1018493099 6:164316990-164317012 TACAATAAATTCAATGCACTTGG + Intergenic
1020243435 7:6412803-6412825 TGCAATAAACCCAAGGTAAGCGG - Exonic
1020852341 7:13371950-13371972 TTAAATAAAATCAATGTAATCGG + Intergenic
1023331353 7:39120651-39120673 TGTCATGAAATCAATGTAGTAGG + Intronic
1030605530 7:111635216-111635238 TGAAATAACCTCTATGCAGTTGG + Intergenic
1031843990 7:126782051-126782073 GATAATAAAATCAATGTAGTTGG + Intronic
1032625203 7:133584394-133584416 TGCATCATTCTCAATGTAGTTGG + Intronic
1033518792 7:142138723-142138745 TGCATTAAATTCAATGTATTAGG + Intronic
1034368610 7:150573896-150573918 AGCAAAAAATTCAATGCAGTGGG - Exonic
1036176451 8:6542810-6542832 TCCAATAAACTGAATTTACTTGG + Intronic
1037285778 8:17298233-17298255 TGCAATATACTATATGTAATAGG - Exonic
1039763959 8:40608430-40608452 GGAAATAAACTCAATGCTGTTGG - Intronic
1042439052 8:68803305-68803327 TGCAATAAACTCAATGTAGTAGG - Intronic
1042844419 8:73156063-73156085 TGCAATAAATTGAATGAACTGGG - Intergenic
1043615923 8:82125223-82125245 TTGAATAACCTCAATCTAGTTGG - Intergenic
1044336619 8:90991168-90991190 TGCTCTAAAATTAATGTAGTTGG + Intergenic
1044363126 8:91311220-91311242 TGCAACAACCTCACTGAAGTGGG - Intronic
1052180196 9:25517408-25517430 TGCAGTAAACTCTATATGGTTGG - Intergenic
1055632061 9:78235019-78235041 TGCAATAAACACAATGTCTAAGG + Intergenic
1055967859 9:81882878-81882900 TTAAATAAACTGAATTTAGTAGG + Intergenic
1056948035 9:91017487-91017509 GGAAATAAACTCAGTGTTGTTGG + Intergenic
1058232360 9:102443568-102443590 TGCAGCAAATTCAATGTATTTGG + Intergenic
1060310799 9:122459639-122459661 CTGAATGAACTCAATGTAGTTGG + Intergenic
1061686197 9:132281504-132281526 TGCAATAAGCTCATCCTAGTAGG - Exonic
1188094747 X:26007616-26007638 TGAAATAAACTCACTGAAATGGG + Intergenic
1188878187 X:35458708-35458730 GGCAATAAACTCAATGCATCAGG + Intergenic
1191697264 X:64003089-64003111 AGCAAGAAAGTCAGTGTAGTTGG + Intergenic
1197186232 X:123590226-123590248 TGCAATAAACTGAAAGTTTTTGG - Intergenic
1197425815 X:126296186-126296208 TGTAATATAATCAATGTAATGGG + Intergenic
1198475179 X:136989546-136989568 TGAAAAAAGCTCAATCTAGTGGG - Intergenic